ID: 1155265198

View in Genome Browser
Species Human (GRCh38)
Location 18:24085676-24085698
Sequence AATTGTGATCAGAGTGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 199}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155265192_1155265198 23 Left 1155265192 18:24085630-24085652 CCACATTATAGCTCTTAGTAGAT 0: 1
1: 0
2: 0
3: 14
4: 142
Right 1155265198 18:24085676-24085698 AATTGTGATCAGAGTGCAGAGGG 0: 1
1: 0
2: 3
3: 19
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155265198 Original CRISPR AATTGTGATCAGAGTGCAGA GGG Intronic
904781572 1:32953322-32953344 AATAGAGGACAGAGTGCAGATGG - Intronic
904935698 1:34128146-34128168 GATTGAGCTCAGAGTCCAGAGGG - Intronic
905004599 1:34699534-34699556 AGTGGAGACCAGAGTGCAGAGGG + Intergenic
908769044 1:67579739-67579761 AAGTGTGTGCAGAGTGCAAAGGG - Intergenic
910606427 1:89090090-89090112 CACAGTGATCAGAGTGCTGAAGG + Intergenic
912410584 1:109478237-109478259 AATTGGAGGCAGAGTGCAGAAGG - Intronic
916660433 1:166918511-166918533 CAATCTAATCAGAGTGCAGAGGG + Exonic
917494066 1:175524204-175524226 CCTTGTGTTCAGAGTCCAGATGG + Intronic
919559719 1:199101627-199101649 AACTCTGCCCAGAGTGCAGAGGG + Intergenic
921780121 1:219153091-219153113 AATTGTGACTGGAGTGTAGAGGG - Intergenic
922155275 1:223036196-223036218 AATTGTGTTCAGAGCCCAAAGGG + Intergenic
922885795 1:229019611-229019633 AATTATGATAGCAGTGCAGAAGG + Intergenic
923177829 1:231485229-231485251 AATAGAGATTAGATTGCAGAAGG + Intergenic
1064809138 10:19174828-19174850 ATTTGTAATCAGTGTGCTGAAGG - Intronic
1065593943 10:27294258-27294280 GATTTTGATCAGAGTCCAGGTGG + Intergenic
1065656446 10:27956307-27956329 GATTTTGATCAGAGTCCAGGTGG - Intronic
1065999921 10:31095123-31095145 AATAGTGATCTGAGAGGAGATGG + Intergenic
1069188081 10:65451949-65451971 AATTGTGATTAGAGAGTAGGTGG - Intergenic
1069827048 10:71260792-71260814 AATTGTGATGAGTGGGCAGTGGG + Intronic
1072677139 10:97476170-97476192 AATTGTGCACAGTGTACAGAAGG - Intronic
1073094268 10:100970163-100970185 AAAGGTGATCAGAGTTCAGGGGG + Intronic
1074504762 10:114059819-114059841 AATTCAGATGAGAGTGCAGAAGG - Intergenic
1074558011 10:114509662-114509684 GATTGAGACCAGACTGCAGAGGG - Intronic
1074838026 10:117317933-117317955 AATTTTGATCAGAGTGGAGAAGG - Intronic
1075240051 10:120770224-120770246 AAATGTGAGCAAAGTGCAGAGGG + Intergenic
1075955424 10:126519162-126519184 AAAGGTGAACAGAGTGGAGAGGG + Intronic
1077729866 11:4718838-4718860 AATGGTGACCAGAGTGGATATGG - Intronic
1078154645 11:8788773-8788795 AATTGTGGTCAGACAGTAGAGGG - Intronic
1079515700 11:21265887-21265909 AATTGGGGTCAGAGGGTAGAGGG - Intronic
1082962395 11:58931306-58931328 AAATGTGATCACACTGCAGTAGG - Intronic
1084890070 11:72232447-72232469 AATTGGGATAAGAGAGCAGGGGG - Intronic
1085750536 11:79157093-79157115 AATTGTAGTCAGAGAGGAGATGG + Intronic
1085952009 11:81343505-81343527 AATTGAGATCAGATGACAGAGGG + Intergenic
1086475756 11:87171371-87171393 ATTTGTGATATGAGTGCTGAGGG + Intronic
1086698776 11:89875516-89875538 GATGGTGATGAGAATGCAGATGG - Intronic
1086707394 11:89968983-89969005 GATGGTGATGAGAATGCAGATGG + Intronic
1087421283 11:97927935-97927957 AATGCTGATCAAAGTGGAGAGGG - Intergenic
1088139295 11:106596163-106596185 AATAGTGATCTGAGTTCTGAGGG + Intergenic
1089730333 11:120515064-120515086 AGTTGGGGTCAGCGTGCAGAGGG - Intronic
1090592451 11:128287043-128287065 TATTGTGATCAGAAGGCAGGAGG - Intergenic
1096069229 12:48765684-48765706 AATTGTGGCAAGAGTGCAGAGGG + Intergenic
1097773362 12:63616520-63616542 ATTTCTGATCAGTGTGGAGATGG + Intronic
1098345557 12:69499325-69499347 AATTGAGATGTGAGTCCAGATGG + Intronic
1098620159 12:72586587-72586609 AAATGTGATCTGAGTTCACAGGG - Intronic
1099089281 12:78284435-78284457 AATTATGTTCATACTGCAGAAGG + Intergenic
1099727070 12:86444501-86444523 AATTGAGATCAGTATGCAGATGG - Intronic
1099898641 12:88680622-88680644 GGTTGTGACCAAAGTGCAGATGG + Intergenic
1100193491 12:92218185-92218207 AAGTGAGAACAGAGTGGAGAAGG + Intergenic
1100510076 12:95261957-95261979 GATTGTGCACAGAGTGCACATGG - Intronic
1101060759 12:100969595-100969617 AATTGTTTTCAAATTGCAGATGG - Intronic
1101948711 12:109157833-109157855 ATTGTGGATCAGAGTGCAGAAGG + Intronic
1102755697 12:115338185-115338207 AACTGGGCTCAGAGTGGAGAAGG + Intergenic
1107614416 13:42149613-42149635 GGTTGTGAGCAAAGTGCAGAAGG - Intronic
1108439460 13:50435833-50435855 AAGCTTGATCAGAGTGAAGAAGG + Intronic
1109952345 13:69515302-69515324 AATTATCATCAGAGTGAACAGGG - Intergenic
1110247673 13:73344625-73344647 AAATTTTATCAGAGAGCAGAGGG - Intergenic
1111455011 13:88470307-88470329 AATTGTGAGCAAAGTACATATGG - Intergenic
1111820016 13:93201805-93201827 AATTATGAACAAAGTGAAGAGGG + Intergenic
1115434489 14:33357684-33357706 AATTGGGACCAGAATGCAGAAGG - Intronic
1118791172 14:69094347-69094369 TAGTGTGATCAGACTGCAGATGG - Intronic
1119084310 14:71725945-71725967 GACTGTGATCAGAGTGCAAGAGG + Intronic
1120434750 14:84466951-84466973 AATTGTGATTATAGAGAAGATGG + Intergenic
1120827496 14:88968986-88969008 TGGTGTGTTCAGAGTGCAGAGGG - Intergenic
1121391024 14:93574698-93574720 CATTGAGATCAGAGTGGGGATGG + Intronic
1121431550 14:93891690-93891712 AAATGTGAGCAGAGTGTGGAAGG - Intergenic
1122319411 14:100844907-100844929 AATTTTGTTCACAGTGCAGTAGG - Intergenic
1122477392 14:102020208-102020230 AACTGTGACCAGTGTCCAGACGG - Intronic
1124171616 15:27378838-27378860 ATTTGTGAACAGATTGGAGAGGG + Intronic
1124582909 15:30977442-30977464 AGTTATAATCTGAGTGCAGAAGG - Intronic
1124899291 15:33807632-33807654 CATGGTGATCACAGTGCAGAGGG - Intronic
1127300709 15:57650983-57651005 AATTATGAGCAGAGTGATGAAGG - Intronic
1128228978 15:66021823-66021845 AATAGTGAACAGAGAGCAGGAGG - Intronic
1131172362 15:90187556-90187578 GAATCTGAGCAGAGTGCAGAGGG + Intronic
1134804700 16:17114336-17114358 ACTTGTGATTAGCGGGCAGAAGG + Intronic
1136291764 16:29277259-29277281 AAATGTGTTCAGAGAGCTGAAGG - Intergenic
1139311626 16:66032722-66032744 AATGGTGTTCACAGTCCAGATGG - Intergenic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1140108130 16:71979749-71979771 GATTGTGATCAGAATGAAAATGG - Intronic
1140752389 16:78037196-78037218 AAATATGATCAGAGTGCTGCTGG - Intronic
1149682678 17:58517137-58517159 ACCTGTGATCAGAGGGCAGCAGG + Intronic
1150944958 17:69734959-69734981 GATTGTGATCAGAGTTAAGAAGG - Intergenic
1153978069 18:10286889-10286911 ATTTTTGGCCAGAGTGCAGAGGG - Intergenic
1155265198 18:24085676-24085698 AATTGTGATCAGAGTGCAGAGGG + Intronic
1156100181 18:33584299-33584321 AATTGCGATCAGATTGGGGAGGG + Intronic
1156358209 18:36361019-36361041 GATTCTGATGAGGGTGCAGAAGG + Intronic
1156754516 18:40505408-40505430 GATTGAGATCTGAGTGCACAGGG + Intergenic
1157695984 18:49724050-49724072 CACTGAGATCAGAGTGCAAATGG - Intergenic
1159625895 18:70693645-70693667 AATTGTGAGCCTATTGCAGAAGG - Intergenic
1160267667 18:77354086-77354108 AATTGTTAACAGAGTTCAGCTGG + Intergenic
1163755078 19:19101748-19101770 ACATGTGATCAGAGGTCAGAGGG - Intronic
1164310256 19:24039749-24039771 TAATGTGATCAGAATGAAGAAGG + Intronic
1166882290 19:45936978-45937000 GATTGAGGTCAGATTGCAGAAGG + Exonic
929041421 2:37748393-37748415 GACTGTGATGAGAATGCAGAGGG - Intergenic
929695940 2:44115274-44115296 AAATATGATCAGAGGACAGAAGG - Intergenic
930910941 2:56628898-56628920 AATTATAATCAGAGTGTAGTGGG + Intergenic
932127484 2:69157045-69157067 AATGGTGCTCAGGGTGCAGTGGG - Intronic
932445530 2:71778680-71778702 AAGTGTGTTCAGAGAGCAAAAGG + Intergenic
934587501 2:95515304-95515326 GATGGTGATGAGAATGCAGATGG + Intergenic
935066381 2:99652146-99652168 AATTATGCTCAGATTTCAGAGGG - Intronic
935232225 2:101108967-101108989 AATTGTGAGGACAGTACAGAGGG - Intronic
936555475 2:113494234-113494256 ACTTGGGAACAGAGAGCAGAAGG - Intronic
937729478 2:125210397-125210419 AATTGTGCTCAGAGTTCACAAGG + Intergenic
938993295 2:136651689-136651711 AATTGTTCTCAGAGTGCTGGGGG + Intergenic
940699142 2:157020108-157020130 AATTGAGGTCATAGTGCAGAGGG + Intergenic
941185355 2:162315709-162315731 AAGTGTGATAAGACTGTAGAAGG - Intronic
941634892 2:167925861-167925883 AATTGTGGTCAGATTAGAGAGGG + Intergenic
942347356 2:175017343-175017365 GGTTGTGATCAAAATGCAGATGG + Intergenic
943065898 2:183085796-183085818 CATTGTAATCAGAAGGCAGAGGG + Intronic
1169003665 20:2189032-2189054 TATTGTGAACAGAGTGTAGAGGG - Intergenic
1172834329 20:37863433-37863455 AGTTGTGAACAGTGTGCTGAGGG + Intronic
1173364978 20:42376846-42376868 AATTGGGGTCAGATTGCAAAGGG + Intronic
1173473693 20:43343323-43343345 AATTATGTTCACAGTGCAGGGGG - Intergenic
1173923986 20:46767230-46767252 AAGTGAGGTCAGAGTGCAGCTGG + Intergenic
1176310492 21:5146474-5146496 AATTGTTCTCAGAGTTCAGAGGG - Intronic
1179562783 21:42227050-42227072 AATTGTGATTACAATGAAGATGG - Intronic
1179846563 21:44115561-44115583 AATTGTTCTCAGAGTTCAGAGGG + Intronic
949212235 3:1516802-1516824 AATTGTAACCAGAGTGAGGATGG + Intergenic
950086491 3:10261983-10262005 AAATGTGATCAGAGTATACAAGG - Intronic
950306350 3:11917641-11917663 AATTCTGAGCAGAGTTCAGGGGG - Intergenic
950829812 3:15861905-15861927 AATGGTGCTCATGGTGCAGAAGG - Intergenic
952059325 3:29488580-29488602 CATTGTGATCATTGTGCAGCTGG - Intronic
954799527 3:53179135-53179157 AGTTGTGATGAGACTGAAGAGGG - Intronic
955685273 3:61543139-61543161 CATTGTGAACAGAGTGTACAAGG - Intergenic
957989154 3:87608794-87608816 AATTTTGCTTAGAGTGTAGATGG + Intergenic
963545693 3:146655537-146655559 ATTTTAGATCAGAGTGCAGGTGG - Intergenic
963761616 3:149291164-149291186 GATTGTGCTAAGAGAGCAGAAGG - Intergenic
965206205 3:165721038-165721060 ATTGGTGATCAAAGTCCAGAGGG + Intergenic
966630095 3:182063077-182063099 AATTTTGACCAGAGAACAGATGG - Intergenic
967473349 3:189888396-189888418 AATTGTGATAATAGTGATGATGG + Intronic
969056095 4:4403801-4403823 AATGCTGACCAGAGTGCAGAAGG + Intronic
970053222 4:11940077-11940099 AATTGTAATCCCAGTGCTGAAGG + Intergenic
971584854 4:28392668-28392690 ACTTGTCATCAGTATGCAGATGG + Intronic
971788732 4:31139356-31139378 AATTTTGATCTCAGTGAAGATGG - Intronic
973268727 4:48237828-48237850 ACTTGTGATGAGATTGCAAATGG - Intronic
973311917 4:48718965-48718987 AGTTGGGGTCAGAGTGCAAATGG - Intronic
974629086 4:64459577-64459599 AATTGTGTGTAGAGGGCAGAAGG + Intergenic
975486106 4:74935142-74935164 AATTAGGATCAGAGCCCAGATGG + Intronic
979825502 4:125228343-125228365 AATTAACATCAGAATGCAGAAGG + Intergenic
981653061 4:147080640-147080662 ATTTCTGATGAGAGTGCACAGGG - Intergenic
981675304 4:147336450-147336472 AATTGTGAACAGATTGCTCATGG - Intergenic
983024840 4:162722989-162723011 TATTGTGAAGAGAGTGCATAAGG + Intergenic
983843322 4:172483346-172483368 CATTGTGAAGGGAGTGCAGAGGG + Intronic
984006782 4:174320929-174320951 AATTATGATGACAGTGGAGATGG + Intronic
985880222 5:2633653-2633675 ATCTGTGTTCAGAGGGCAGAGGG + Intergenic
986753446 5:10811551-10811573 AATGGGGATCAGAGTGGGGAGGG + Intergenic
986780707 5:11062772-11062794 AGTTTTGTTCAGAGTGCATAAGG - Intronic
987054946 5:14182410-14182432 AATTGTTGTCAGAGTGTAGGTGG + Intronic
988022303 5:25636713-25636735 TATTGTGATCTGAATGTAGATGG - Intergenic
988997313 5:36726843-36726865 ACTTTTGAGCAGAGTGCAGGAGG + Intergenic
989116745 5:37962189-37962211 AGTTGGGATCAGATTGAAGAAGG + Intergenic
989239021 5:39182230-39182252 CAGTGTGAACAGAGTGCAGGTGG + Intronic
990945577 5:61245695-61245717 AATTATGGTTAGAGTGCAGGCGG + Intergenic
991111248 5:62902121-62902143 AACTGTGATAAGAGAGGAGAGGG + Intergenic
995548373 5:113255210-113255232 CACTGTGATCAGATTGCAAAAGG - Intronic
997786907 5:136721829-136721851 ACTTCTGATCAGGCTGCAGATGG + Intergenic
998499508 5:142620021-142620043 TCTTGTAATCAGAGTGCAGATGG - Intronic
1001180760 5:169517965-169517987 AACTGTCATCAGAGTGAACAGGG - Intergenic
1001681470 5:173560668-173560690 AATAGTGAACATAGGGCAGAAGG - Intergenic
1001806936 5:174594742-174594764 AATTGTGATCAAATTCCAGAGGG + Intergenic
1002848428 6:969271-969293 TATAGTGATCAGAGAGCAGTAGG - Intergenic
1004698392 6:18055647-18055669 CATGGAGATGAGAGTGCAGAAGG - Intergenic
1005167033 6:22936765-22936787 AATGGTGATGAGAGCGCTGAGGG - Intergenic
1005603607 6:27452702-27452724 AAATGTGATCAGTGTGGAAAAGG - Exonic
1008878846 6:56360121-56360143 AATGGTGATGAGAAAGCAGAAGG + Intronic
1010251928 6:73715952-73715974 AATGGAGATAAGAGTGTAGAAGG - Intronic
1011095009 6:83651584-83651606 CATTGTGGTCTGAGAGCAGATGG + Intronic
1011169333 6:84488734-84488756 AATTGAGAACAGAGTGAAGGGGG + Intergenic
1012309659 6:97706573-97706595 AATTGTAAGCAGAGTGCAGAAGG - Intergenic
1012498642 6:99863620-99863642 GATTGTGAGCAGCCTGCAGATGG + Intergenic
1012531782 6:100246402-100246424 AATTTTGAACAAAGTCCAGATGG + Intergenic
1013349792 6:109295043-109295065 AATTATGATCTAACTGCAGAAGG - Intergenic
1013743492 6:113317588-113317610 AACCTTGCTCAGAGTGCAGATGG + Intergenic
1013848834 6:114488826-114488848 AATTCTATTCAAAGTGCAGATGG + Intergenic
1014925805 6:127267907-127267929 AATTGTTTTAAGAGTGGAGACGG + Intronic
1016703735 6:147082676-147082698 AATTGTTTCCAGAGTTCAGAGGG - Intergenic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1018533252 6:164790440-164790462 AATTGTGCTGAGAATACAGAAGG - Intergenic
1022932928 7:35140249-35140271 ATTTCTGATCAGTGTGGAGATGG + Intergenic
1023116047 7:36863696-36863718 AATTGTGATCAGTGTGTACATGG - Intronic
1023133550 7:37027776-37027798 AATTGTTATCACAGTGCTGGAGG - Intronic
1023191592 7:37588960-37588982 AACTGTCATCAGAGTGAACAGGG + Intergenic
1023302582 7:38789564-38789586 CATCGTTCTCAGAGTGCAGATGG - Intronic
1027509327 7:79059852-79059874 ATTTACAATCAGAGTGCAGAAGG - Intronic
1028239286 7:88399501-88399523 TATGGTGAGCAAAGTGCAGAGGG + Intergenic
1028601250 7:92602701-92602723 AATTGGGATGACAGTCCAGAGGG + Intergenic
1029828846 7:103233016-103233038 ATTTCTGATCAGTGTGGAGATGG + Intergenic
1031423809 7:121581671-121581693 AATGGGGAGCAGATTGCAGAGGG + Intergenic
1033661598 7:143406797-143406819 ATTTGTGTTGAGAGTGCAGTAGG + Intronic
1033772564 7:144568617-144568639 AATTATAATCAGAGGGCTGATGG - Intronic
1033845699 7:145429053-145429075 AAATGTCATCAGAGTGTAGAAGG + Intergenic
1035387361 7:158483078-158483100 AAGTGTGATCGGAGGGCAAAGGG - Intronic
1036501975 8:9322365-9322387 ATCTGTGAAAAGAGTGCAGATGG - Intergenic
1038453292 8:27653651-27653673 AACTGTGACCAAAGTCCAGAGGG + Intronic
1038664160 8:29522957-29522979 AATGGTGTGCAGAGTGCAGGAGG + Intergenic
1039721782 8:40172547-40172569 AATTTAAATCAGAGTACAGAAGG - Intergenic
1040486997 8:47883095-47883117 CATCGTGATGAGAGTGCACAGGG + Intronic
1041237146 8:55815341-55815363 AATTTTGATCAGATTACAGTGGG + Intronic
1041847868 8:62352286-62352308 GATCTTGATCAGAGTGCTGAGGG - Intronic
1043036208 8:75203274-75203296 AATTATCATCAGAGTGAATAGGG - Intergenic
1043931165 8:86093100-86093122 AATTGTGATTATATTGCAAAAGG + Intronic
1049897519 9:122955-122977 ACTTGGGAACAGAGAGCAGAAGG + Intronic
1049906808 9:225374-225396 AATAGTTAGCAGTGTGCAGAAGG + Intronic
1050465459 9:5918215-5918237 ATTTGTTATCAAAGTGGAGAGGG - Intronic
1053365711 9:37521185-37521207 AGTTGGGATCAGTCTGCAGAAGG + Intronic
1053740613 9:41133243-41133265 ACTTGGGAACAGAGAGCAGAAGG + Intronic
1054443602 9:65289396-65289418 ACTTGGGAACAGAGAGCAGAAGG + Intergenic
1054486672 9:65732107-65732129 ACTTGGGAACAGAGAGCAGAAGG - Intronic
1054687737 9:68298057-68298079 ACTTGGGAACAGAGAGCAGAAGG - Intronic
1055226042 9:73997337-73997359 AATTCTGAGAAGAGAGCAGAAGG - Intergenic
1056809793 9:89755339-89755361 AATTGTGTTCACAGTGTAGGTGG + Intergenic
1057579141 9:96270464-96270486 AAATATGCTGAGAGTGCAGATGG + Intronic
1058528767 9:105885684-105885706 GATGGTGATTAGAGTGCAGGAGG - Intergenic
1061190577 9:129080570-129080592 AACTGAGACCAGAGAGCAGAGGG - Intergenic
1061641802 9:131964043-131964065 GATTGTGAGGAGAGTGGAGAAGG + Intronic
1186612942 X:11156178-11156200 AATTCTGATAAGCGTGCATAGGG - Intronic
1187030186 X:15478777-15478799 AAGTGTGAGCAGAAGGCAGAGGG - Intronic
1188462219 X:30441646-30441668 AATTCTTATCAGAGAGGAGAAGG - Intergenic
1188559865 X:31455286-31455308 AATTGTGATCAGGGTTCAGAAGG - Intronic
1188609164 X:32074790-32074812 AATTGCAATCAGATTCCAGATGG + Intronic
1194050265 X:89059467-89059489 AAGTGTGATCAGAGGACAAAAGG + Intergenic
1198632558 X:138657058-138657080 AATTGAGCTCAGAGTGCACAGGG - Intronic
1198875162 X:141216851-141216873 AAGGGTGATCAGAGTGTTGATGG - Intergenic