ID: 1155266499

View in Genome Browser
Species Human (GRCh38)
Location 18:24099423-24099445
Sequence ACTGGAACTGTATTAGGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 523
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 483}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155266499_1155266507 15 Left 1155266499 18:24099423-24099445 CCACCTCCTAATACAGTTCCAGT 0: 1
1: 0
2: 2
3: 37
4: 483
Right 1155266507 18:24099461-24099483 ATGTATCAATTTTGTGAGGCAGG 0: 1
1: 1
2: 1
3: 22
4: 288
1155266499_1155266506 11 Left 1155266499 18:24099423-24099445 CCACCTCCTAATACAGTTCCAGT 0: 1
1: 0
2: 2
3: 37
4: 483
Right 1155266506 18:24099457-24099479 TTTCATGTATCAATTTTGTGAGG 0: 1
1: 0
2: 7
3: 74
4: 578

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155266499 Original CRISPR ACTGGAACTGTATTAGGAGG TGG (reversed) Intronic
900731731 1:4266374-4266396 ATTGTAACAGTACTAGGAGGTGG + Intergenic
901235328 1:7664560-7664582 CCTGGAACTGCATGAGGTGGAGG - Exonic
902642433 1:17775352-17775374 CCTGGAACTGGAGGAGGAGGAGG + Intronic
902723713 1:18321724-18321746 AATGGAATTGTATTAGAAGGAGG - Intronic
903516027 1:23911657-23911679 ACTGGTACTGTAAAATGAGGTGG + Intronic
903551682 1:24161571-24161593 ACTGGATCTGAAGTATGAGGTGG - Exonic
903588431 1:24436096-24436118 AAGGGAATGGTATTAGGAGGTGG - Intronic
903842237 1:26251655-26251677 AATGTAACAGTATTAAGAGGTGG - Intronic
904968792 1:34402626-34402648 AATGTAACAGTATTGGGAGGTGG - Intergenic
905472140 1:38201266-38201288 AATGCAACAGTGTTAGGAGGTGG - Intergenic
905473324 1:38208747-38208769 ACTGGAAGTGTATGTGTAGGGGG + Intergenic
906857114 1:49319892-49319914 ACAGTAACAGTATTAAGAGGTGG - Intronic
906994682 1:50779487-50779509 ACTGATACTGTGTTAGCAGGCGG + Intronic
907151006 1:52287494-52287516 ATTAGAACAATATTAGGAGGTGG + Intronic
908176696 1:61562856-61562878 AATGCAACAGTATTAAGAGGTGG - Intergenic
908894435 1:68882469-68882491 TCTGGGACTGTAAGAGGAGGAGG + Intergenic
909671460 1:78193745-78193767 AATGCAACAGTATTGGGAGGTGG - Intergenic
910071330 1:83217935-83217957 GCAGGAACTGTACTAGGAGAAGG + Intergenic
910290585 1:85596661-85596683 ACTGGAATTGTAGAAGGAAGCGG - Intergenic
910892570 1:92032903-92032925 ATTGTAACAGTATTAAGAGGTGG - Intronic
911270456 1:95795412-95795434 ATTGTAACAGTATTAAGAGGTGG - Intergenic
911672249 1:100620349-100620371 ATTGTAACAGTATTAAGAGGTGG + Intergenic
911762387 1:101631260-101631282 AATGCAACAGTATTGGGAGGTGG - Intergenic
912022561 1:105123315-105123337 AATGCAACAGTATTGGGAGGTGG - Intergenic
912106295 1:106280795-106280817 AATGTAACAGTATTAAGAGGTGG + Intergenic
912202567 1:107474852-107474874 ACTGTAACAGTATTAAGAAGTGG - Intronic
913202470 1:116506368-116506390 ACTGTAACAGTATTAAGAGGTGG - Intergenic
914438020 1:147677776-147677798 AGTGCAACAGTATTAAGAGGTGG - Intergenic
916200119 1:162263448-162263470 AATGCAACAGTGTTAGGAGGTGG - Intronic
916598740 1:166271995-166272017 ACTGTGATGGTATTAGGAGGTGG - Intergenic
917282127 1:173387247-173387269 AATGCAACAGTATTAAGAGGTGG + Intergenic
917285077 1:173415016-173415038 ACAGGAACTTGATTAGGTGGAGG - Intergenic
917500714 1:175582770-175582792 ATTGTAACAGTATTAAGAGGTGG + Intronic
917639252 1:176967067-176967089 ATTGGAACTATATAAGGAAGTGG + Intronic
917655027 1:177117615-177117637 ATTTGAACTTTATTAGGGGGTGG - Intronic
918111270 1:181457298-181457320 ACGGGGATGGTATTAGGAGGTGG - Intronic
920677192 1:208046359-208046381 GCTGGCACTGTGCTAGGAGGTGG + Intronic
921022844 1:211252278-211252300 ACTGTGATTGTATTAAGAGGTGG + Intergenic
921133270 1:212237842-212237864 AGTGAAACAGTATCAGGAGGTGG - Intergenic
921421923 1:214958314-214958336 AATGTAATGGTATTAGGAGGTGG - Intergenic
921756017 1:218856467-218856489 ACTGTAACAGTATTATGAGGAGG + Intergenic
922708475 1:227806776-227806798 AGTGTAATGGTATTAGGAGGTGG + Intergenic
924464349 1:244286482-244286504 AGTGGAAAGGTATTTGGAGGTGG + Intergenic
1063718304 10:8552689-8552711 AATGGGAGGGTATTAGGAGGTGG - Intergenic
1064213225 10:13378298-13378320 ACTTTAAAAGTATTAGGAGGTGG + Intergenic
1065114384 10:22470543-22470565 AATGCAACAGTATTAAGAGGTGG - Intergenic
1065267271 10:23990501-23990523 ACAGAAACTGAATTAGGAGAAGG - Intronic
1065881866 10:30043961-30043983 ATTGTAACAGTATTAAGAGGTGG + Intronic
1067219229 10:44331176-44331198 ATTGCAACAGTATTAAGAGGTGG - Intergenic
1067431847 10:46250475-46250497 CCTGGAACTGTGGGAGGAGGGGG - Intergenic
1067794251 10:49309238-49309260 AGTGGAATGGTATTAGGAGATGG + Intronic
1067834708 10:49631455-49631477 AATGTAACTGTATTTGGAGATGG - Intronic
1069751316 10:70747163-70747185 ACTGGAGCTGTGTTAAGGGGAGG - Intronic
1070336495 10:75459937-75459959 AATGCAACAGTGTTAGGAGGTGG - Intronic
1070462116 10:76680715-76680737 ACTGTGACTGTATTTGGAGATGG + Intergenic
1070688881 10:78510224-78510246 AGTGCAATAGTATTAGGAGGTGG - Intergenic
1071501648 10:86208339-86208361 ACTGGAGCTGGGGTAGGAGGGGG - Intronic
1072339719 10:94434913-94434935 AATGCAACAGTATTTGGAGGTGG - Intronic
1073629736 10:105136406-105136428 AATGCAACAGTATTAAGAGGTGG - Intronic
1073936690 10:108640840-108640862 ACTGTGTCTGTATTATGAGGCGG + Intergenic
1073937240 10:108648128-108648150 AATGGGATAGTATTAGGAGGTGG + Intergenic
1075160959 10:120024203-120024225 ATTGTAGCTGTATTAAGAGGTGG - Intergenic
1075586671 10:123663569-123663591 AATGCAACAGTATTGGGAGGTGG - Intergenic
1075872375 10:125780146-125780168 AGTGCAACCGTATTAAGAGGTGG + Intergenic
1076425841 10:130367087-130367109 AATGGGATAGTATTAGGAGGTGG + Intergenic
1076478111 10:130766632-130766654 AGTGCAACAGTATTAAGAGGGGG + Intergenic
1076749583 10:132536095-132536117 AATGTGACTGTATTCGGAGGTGG - Intergenic
1076906038 10:133361634-133361656 ACCGTGACTGCATTAGGAGGGGG - Intergenic
1076935194 10:133564114-133564136 AGTGTGACTGCATTAGGAGGTGG + Intronic
1077221772 11:1421118-1421140 CCTGGGACTGTACCAGGAGGAGG - Intronic
1077575945 11:3383584-3383606 ACAGAAACTGAATGAGGAGGGGG + Intergenic
1077588726 11:3475128-3475150 ACTGGAATTATATCAGGAGCTGG + Intergenic
1078073212 11:8133014-8133036 ATTGCAACAGTATTAAGAGGTGG + Intronic
1080498765 11:32848327-32848349 AATGCAACAGTATTAGGAGGTGG - Intronic
1081189213 11:40082082-40082104 AATGCAACTGTGTTGGGAGGTGG + Intergenic
1081305947 11:41512487-41512509 AGTGCAACAGTATTGGGAGGTGG + Intergenic
1081992966 11:47347517-47347539 ACTGGAAAGGGATTAGGAGCAGG + Intronic
1082789783 11:57339166-57339188 ACTGGATCTGTTTTAGAATGAGG + Intronic
1082965007 11:58958228-58958250 ACTCCAAATGTATTTGGAGGTGG - Intronic
1084244420 11:67846755-67846777 ACTGGAATTATATCAGGAGCTGG + Intergenic
1084828262 11:71747806-71747828 ACTGGAATTATATCAGGAGCTGG - Intergenic
1085334519 11:75681119-75681141 AGTGGGATGGTATTAGGAGGTGG + Intergenic
1085433020 11:76472765-76472787 ACTGCAACTGTATTAGGAATAGG - Exonic
1086937519 11:92761365-92761387 AATGCAATAGTATTAGGAGGTGG - Intronic
1087149360 11:94844748-94844770 ATTGTAACAGTATTAAGAGGTGG - Intronic
1087822515 11:102728498-102728520 AGTGTGACGGTATTAGGAGGTGG + Intergenic
1087948024 11:104188450-104188472 AATGGATCAGTATTGGGAGGTGG - Intergenic
1088449913 11:109970394-109970416 GATGGAACTGAATTAGGAGGAGG - Intergenic
1089883744 11:121799804-121799826 ACTGTGACAGTATTAGAAGGTGG - Intergenic
1089918433 11:122182881-122182903 AATGTGACGGTATTAGGAGGTGG + Intergenic
1090090545 11:123693478-123693500 CCTGGAACTGTTCTAGGAGATGG + Intergenic
1091118318 11:133035683-133035705 AATGTAACTGTATTTGGAGATGG + Intronic
1091196476 11:133735534-133735556 AGTGCAACAGTATTAGGAGATGG - Intergenic
1092361304 12:7838818-7838840 AATGGAACTGTATTTGGAGATGG + Intronic
1092375743 12:7954082-7954104 AATGGAACTGTATTTGGAGATGG + Intergenic
1092414986 12:8283898-8283920 ACTGGAATTATATCAGGAGCTGG + Intergenic
1092829259 12:12427912-12427934 AGTGTAATGGTATTAGGAGGTGG - Intronic
1093011231 12:14109519-14109541 ACTGGATCCGTTTTTGGAGGTGG - Intergenic
1093131270 12:15394122-15394144 AATGTAACAGTATTGGGAGGTGG - Intronic
1093748184 12:22767000-22767022 AGTGGAATTATAGTAGGAGGAGG + Intergenic
1094114733 12:26898903-26898925 ACTGTAACAGTATGAAGAGGTGG + Intergenic
1094165187 12:27436179-27436201 ACTGTGATGGTATTAGGAGGTGG - Intergenic
1094212649 12:27908796-27908818 AAGGGGACTGTATTAGGAGGTGG - Intergenic
1096900820 12:54879541-54879563 AGTGCATCAGTATTAGGAGGTGG - Intergenic
1098094714 12:66942766-66942788 AATGGCATGGTATTAGGAGGCGG + Intergenic
1098442512 12:70533650-70533672 AATGCAACAGTATTAAGAGGTGG + Intronic
1098947211 12:76602142-76602164 AGTGCAACAGTATTAGGAGGTGG - Intergenic
1099232330 12:80041146-80041168 AGTGGGATGGTATTAGGAGGTGG + Intergenic
1099934084 12:89104953-89104975 ATTGCAACAGTATTAAGAGGTGG - Intergenic
1100450328 12:94699705-94699727 AGTGCAATGGTATTAGGAGGTGG - Intergenic
1101086066 12:101237972-101237994 ACTGGAATTAAATTCGGAGGTGG + Intergenic
1101614108 12:106319286-106319308 AATGGAATGGTATTAGAAGGTGG - Intronic
1102597352 12:114002960-114002982 AATGGAATTGTATTTGGAGATGG - Intergenic
1104791744 12:131487077-131487099 ACGGGGATGGTATTAGGAGGTGG - Intergenic
1105398028 13:20059536-20059558 ACAGGAACTGTAGTAGGAACAGG - Exonic
1105718970 13:23095146-23095168 ATTGTAACAGTATTAAGAGGTGG + Intergenic
1105968041 13:25402669-25402691 AGTGCAACAGTATTAAGAGGTGG + Intronic
1106305866 13:28508739-28508761 AATGTGACAGTATTAGGAGGTGG - Intergenic
1106728033 13:32506311-32506333 AATGTAACTGTATTTGGAGATGG - Intronic
1106943933 13:34804586-34804608 ACTGTAACAGTATTAAGAGTTGG + Intergenic
1107105005 13:36633628-36633650 AATGCAACAGTATTAAGAGGTGG + Intergenic
1107260570 13:38485574-38485596 ACTGAAACAGTGTTGGGAGGTGG - Intergenic
1107391108 13:39965152-39965174 ACTGAAACAGTATTAAAAGGTGG - Intergenic
1107948790 13:45443694-45443716 AATGTAATAGTATTAGGAGGTGG + Intergenic
1108040666 13:46337010-46337032 ATTGTGACAGTATTAGGAGGTGG + Intergenic
1108055189 13:46478349-46478371 AGTGCAACAGTATTAGGAGGTGG + Intergenic
1109034982 13:57245682-57245704 TCTGAAAATGTATTTGGAGGTGG - Intergenic
1109081994 13:57915545-57915567 ACAGGACCTTGATTAGGAGGTGG + Intergenic
1110051242 13:70902482-70902504 AGTGTAACAGTATTAAGAGGTGG + Intergenic
1110325298 13:74207243-74207265 ACTGTAACATTATTAAGAGGTGG - Intergenic
1111088393 13:83407588-83407610 AATGTAATTGTATTGGGAGGTGG + Intergenic
1111812187 13:93104886-93104908 AGTGTAACAGTACTAGGAGGTGG + Intergenic
1113086115 13:106570790-106570812 AATGTAATGGTATTAGGAGGTGG - Intergenic
1115115134 14:29871899-29871921 ACTTTAACTGGATTAGTAGGTGG - Intronic
1116054987 14:39852575-39852597 AGTGCAACAGTGTTAGGAGGTGG - Intergenic
1116255852 14:42554312-42554334 AGAGGAACAGTATGAGGAGGAGG + Intergenic
1116386766 14:44340423-44340445 AATGTAATGGTATTAGGAGGCGG - Intergenic
1116439693 14:44937958-44937980 CATTGAACAGTATTAGGAGGTGG - Intronic
1116863863 14:50015744-50015766 AATGGAATAGTATTAAGAGGGGG + Intergenic
1117575780 14:57095751-57095773 ACTGTGACAGTATTGGGAGGTGG - Intergenic
1118151702 14:63196771-63196793 AGTGCAACTGTATTAAGTGGTGG + Intergenic
1118226669 14:63907010-63907032 AATGTCACGGTATTAGGAGGTGG - Intronic
1118376456 14:65181408-65181430 ACTCAAACTGTCTTAAGAGGGGG - Intergenic
1119608878 14:76044859-76044881 AGTGGAAATGGATCAGGAGGAGG - Intronic
1120062401 14:79999578-79999600 AGTAGAACGGTATTAAGAGGTGG - Intergenic
1121960896 14:98258474-98258496 AATGCAACAGTATTGGGAGGTGG - Intergenic
1123668779 15:22631907-22631929 ATTGAAACAGTATTAAGAGGTGG - Intergenic
1124412104 15:29445114-29445136 AATGTGATTGTATTAGGAGGTGG + Intronic
1124431131 15:29609393-29609415 ATTGTAACAGTATTAAGAGGTGG + Intergenic
1124524752 15:30438387-30438409 ATTGAAACAGTATTAAGAGGTGG - Intergenic
1124642559 15:31405075-31405097 ACTGTGATGGTATTAGGAGGAGG + Intronic
1125120687 15:36155358-36155380 ATTGTGACTGTATTTGGAGGTGG - Intergenic
1127402155 15:58599597-58599619 CCTGGAAGTGGTTTAGGAGGAGG + Exonic
1127654492 15:61043663-61043685 ACTGGCAGTGTATTGGGATGTGG - Intronic
1128568137 15:68714655-68714677 GCTGGAAAGGTAGTAGGAGGTGG + Exonic
1128836656 15:70814259-70814281 AGTGTAACAGTATTAAGAGGTGG - Intergenic
1129151422 15:73690674-73690696 ACTGTAACAGTATTAAGAGGTGG - Intronic
1130331640 15:82926718-82926740 ATTGTAACAGTATTAAGAGGTGG + Intronic
1130399283 15:83534078-83534100 ACTGTAACAGTATTAAAAGGTGG + Intronic
1130685560 15:86034014-86034036 ATTGTAACTGTATTAAGAGGTGG - Intergenic
1130833828 15:87630148-87630170 AATGCAACAGTATTAAGAGGTGG - Intergenic
1131436140 15:92423750-92423772 AATGCAACAGTGTTAGGAGGTGG - Intronic
1131841705 15:96444188-96444210 AATGCAACAGTATTAAGAGGTGG - Intergenic
1131935048 15:97494471-97494493 ACTGGAACTCTATTAAAAGTTGG + Intergenic
1132152436 15:99472328-99472350 AGTGGGATGGTATTAGGAGGTGG - Intergenic
1134285661 16:12860095-12860117 ATTGTAACAGTATTAGGAGGTGG + Intergenic
1135137832 16:19898026-19898048 AATGGGATGGTATTAGGAGGTGG - Intergenic
1135387606 16:22057450-22057472 AATGCAACTGTGTTGGGAGGTGG - Intronic
1137283527 16:46998011-46998033 AATGCAATAGTATTAGGAGGTGG - Intergenic
1137691231 16:50429486-50429508 AATGCAACAGTATTAAGAGGTGG + Intergenic
1139674763 16:68515852-68515874 AATGTGATTGTATTAGGAGGTGG - Intergenic
1141222863 16:82087955-82087977 AATGAAACAGTGTTAGGAGGTGG - Intronic
1141240050 16:82257526-82257548 AATGGGATGGTATTAGGAGGTGG + Intergenic
1142437570 16:90071710-90071732 ATTGTAACAGTATTAAGAGGTGG - Intronic
1143851149 17:9813035-9813057 AATGTAATGGTATTAGGAGGTGG - Intronic
1144048339 17:11473580-11473602 ATTGTAACAATATTAGGAGGTGG - Intronic
1144368639 17:14569248-14569270 ACAGTAACTGAGTTAGGAGGAGG - Intergenic
1144650799 17:17005610-17005632 ACAAGAACTGTGTTAGGAGAAGG + Intergenic
1145931332 17:28688026-28688048 ACTGGAACAGTCTGGGGAGGTGG + Intronic
1146928146 17:36759058-36759080 AATGCAACAGGATTAGGAGGTGG + Intergenic
1147763762 17:42818927-42818949 ACTGGCATTGTAGTAGGTGGAGG - Intronic
1148676588 17:49449081-49449103 AGTGGGACTGTATTTGGAGACGG + Intronic
1149635249 17:58162096-58162118 AGTGGAATGGTATTTGGAGGTGG + Intergenic
1149907683 17:60541609-60541631 AGTGTAACAGTGTTAGGAGGTGG + Intergenic
1150668576 17:67169559-67169581 ATTGGGACAGTATTAAGAGGTGG - Intronic
1151072599 17:71233123-71233145 AATGTAACAGTATTAGGAGGCGG + Intergenic
1151265200 17:72949680-72949702 ACAGTGATTGTATTAGGAGGTGG - Intronic
1151449574 17:74189964-74189986 GGTGGAACAGTATTAAGAGGTGG + Intergenic
1151729738 17:75904305-75904327 GCTGGAACTCTAATAGTAGGGGG + Intronic
1152105194 17:78324613-78324635 ACTGGAACTGAAAAAGGAGAAGG - Intergenic
1152968100 18:135289-135311 AATGGAAATGTAGTATGAGGGGG - Intergenic
1153688844 18:7570865-7570887 ACTGGAAAAGTATTAGGATTTGG + Intronic
1155266499 18:24099423-24099445 ACTGGAACTGTATTAGGAGGTGG - Intronic
1155298246 18:24405288-24405310 ACTGTAACAGTATTAAGAGGTGG + Intergenic
1156069879 18:33194063-33194085 ATTGTAACAGTATTAAGAGGTGG - Intronic
1156670174 18:39459230-39459252 AATGGGACTGTATTTGGAGATGG - Intergenic
1156721864 18:40079954-40079976 ATTAAAACTGGATTAGGAGGAGG - Intergenic
1156782301 18:40865396-40865418 AATGGAACAGTACTAAGAGGTGG - Intergenic
1157019043 18:43756928-43756950 ACTGTAACAGTGTTAGAAGGTGG - Intergenic
1158094526 18:53755644-53755666 ACTGTAACAGTTTTAAGAGGTGG - Intergenic
1158513587 18:58112867-58112889 AATGGGATGGTATTAGGAGGTGG + Intronic
1158826211 18:61223029-61223051 ACAGTAACAGTATTAAGAGGTGG - Intergenic
1158837014 18:61341428-61341450 AATGGAACGGCATTAGGCGGGGG - Intronic
1158858938 18:61573099-61573121 AATGCAATAGTATTAGGAGGTGG + Intergenic
1159454573 18:68644538-68644560 ACTGCAACAGTGTTGGGAGGTGG + Intergenic
1159687161 18:71436955-71436977 AATGTAATTGTATTAAGAGGCGG + Intergenic
1159780769 18:72658227-72658249 AATGCAACAGTATTAAGAGGTGG + Intergenic
1161078935 19:2300817-2300839 AATGGAACTGGAGTAGGGGGAGG + Intronic
1162307119 19:9881890-9881912 AATGTGACTGTATTTGGAGGTGG - Intronic
1162605589 19:11705004-11705026 ACTGCAACACTATTGGGAGGAGG - Intergenic
1162835471 19:13314377-13314399 AATGTAACAGTATTAAGAGGTGG + Intronic
1163316527 19:16544129-16544151 AGTGAAACAGTATTAAGAGGTGG + Intronic
1163966041 19:20748421-20748443 ACTGGAATTATATCAGGAGCTGG + Intronic
1167244015 19:48363284-48363306 GCGGTACCTGTATTAGGAGGCGG + Exonic
1167533824 19:50036288-50036310 AATGTAGCTGTATTAAGAGGTGG + Intronic
1168566658 19:57430400-57430422 ACTGTAACAATATTAAGAGGTGG - Intronic
925031929 2:656960-656982 AGTGGGACTGTATTTGGTGGTGG - Intergenic
925258963 2:2512966-2512988 CCAGGCACTATATTAGGAGGTGG + Intergenic
925498030 2:4473972-4473994 ACTGTAATGGTATTAGGAGGTGG + Intergenic
928063684 2:28141109-28141131 AATGCAATAGTATTAGGAGGTGG - Intronic
929135407 2:38619105-38619127 ATTGTAACAGTATTAAGAGGTGG + Intergenic
930689135 2:54341212-54341234 ATTGTAACTGTATTAAAAGGTGG + Intronic
930693011 2:54383774-54383796 ATTGTAACAGTATTAAGAGGTGG + Intergenic
930886869 2:56335978-56336000 ATTGTAACAGTATTAAGAGGTGG - Intronic
931110762 2:59108838-59108860 ATTGTAACAGTATTAGGAGGTGG + Intergenic
931295806 2:60923985-60924007 CCTGGAGCTGCATGAGGAGGTGG - Exonic
932299145 2:70653099-70653121 AATGTGATTGTATTAGGAGGTGG + Intronic
932325799 2:70860809-70860831 TCTGGGACTGGTTTAGGAGGAGG - Intergenic
932442421 2:71745991-71746013 ATTGTAACAGTATTAAGAGGTGG + Intergenic
932515853 2:72348259-72348281 AAGGGAACTATATTAGGAGGTGG - Intronic
933131601 2:78679147-78679169 AATGCAATAGTATTAGGAGGCGG - Intergenic
933165904 2:79074407-79074429 ATTGTAACTATATTAAGAGGTGG + Intergenic
934569355 2:95359004-95359026 ACTGCAACAGTATTAAGAGATGG - Intronic
934569617 2:95360870-95360892 ACTGTGACAGTATTAAGAGGTGG - Intronic
934891305 2:98072343-98072365 ACTGCTACTGAATTAGGAGTGGG - Intergenic
934916670 2:98305794-98305816 ACTGGGACTGTGGCAGGAGGAGG - Intronic
934985948 2:98884599-98884621 AGTGCAATGGTATTAGGAGGTGG + Intronic
935448702 2:103185608-103185630 AATGCAGCTGTATTAGGAGATGG + Intergenic
936766288 2:115852454-115852476 AATGTAACTGTATTAAGAAGTGG - Intergenic
937466442 2:122137135-122137157 AATGCAACTGTGTTGGGAGGTGG - Intergenic
937657857 2:124397500-124397522 ACTGTCACATTATTAGGAGGTGG - Intronic
938171011 2:129076710-129076732 AAAGGAATGGTATTAGGAGGTGG + Intergenic
938927546 2:136058026-136058048 ATTGTAACAGTATTAAGAGGTGG - Intergenic
940408528 2:153333247-153333269 ACTGGAGCTGTCTTGGGAAGAGG - Intergenic
941446309 2:165604109-165604131 ACTGCACTAGTATTAGGAGGTGG + Intronic
942911635 2:181251540-181251562 ACCTTAACAGTATTAGGAGGTGG + Intergenic
943327408 2:186517748-186517770 ACAGCAATTGAATTAGGAGGTGG + Intergenic
943690829 2:190868236-190868258 ATTGTAACAGTATTAAGAGGTGG - Intergenic
943801022 2:192057505-192057527 TCTGGAACTGGATTAAGAGGTGG - Intronic
943862409 2:192884700-192884722 AGTGCAACAGTATTGGGAGGTGG - Intergenic
944031476 2:195239828-195239850 AGTGCAACAGTATTTGGAGGTGG - Intergenic
944379708 2:199093682-199093704 ATTGTAACAGTATTAAGAGGTGG - Intergenic
944381106 2:199111826-199111848 AGTGTAATGGTATTAGGAGGTGG + Intergenic
944653105 2:201851575-201851597 AATGCAACAGTATTAAGAGGTGG - Intronic
945517156 2:210776410-210776432 AATGGAACAGTGTTAAGAGGTGG - Intergenic
947595250 2:231407222-231407244 ACTGGAATTATATCAGGAGCTGG - Intergenic
948956726 2:241298754-241298776 GCTGGAACAGTACAAGGAGGAGG - Intronic
1169111245 20:3035641-3035663 AGTGGAACTGAAGAAGGAGGAGG + Exonic
1169802369 20:9523305-9523327 ACTGAAACTGTTTGAAGAGGTGG - Intronic
1170013689 20:11756702-11756724 AATGGGATGGTATTAGGAGGTGG - Intergenic
1170184518 20:13573271-13573293 ATTGGGATTGCATTAGGAGGTGG + Intronic
1170530964 20:17291020-17291042 ACTGTAACAATATTAAGAGGTGG - Intronic
1170722747 20:18898197-18898219 ACTGTGATGGTATTAGGAGGTGG + Intergenic
1170776478 20:19379242-19379264 TCTGGCACTGTACTAGGAGCTGG + Intronic
1170946799 20:20898672-20898694 AATGTGATTGTATTAGGAGGTGG + Intergenic
1171332202 20:24350375-24350397 ACTGTAACAGTATTAAGAGATGG + Intergenic
1171421093 20:25018120-25018142 ATTGTAACAGTATTAAGAGGTGG + Intronic
1174504856 20:51010502-51010524 AATGGGATGGTATTAGGAGGTGG + Intronic
1177048445 21:16201094-16201116 ATTGAAACAGTATTAAGAGGTGG - Intergenic
1177258819 21:18701602-18701624 ACTGTAATAGTATTAGCAGGTGG - Intergenic
1178519479 21:33276513-33276535 ACTGGTACTTAATTTGGAGGGGG - Intronic
1178750438 21:35297405-35297427 AATGTGACAGTATTAGGAGGTGG + Intronic
1179155072 21:38842651-38842673 AATGGGACTGTATTAGGAGGTGG + Intergenic
1179165826 21:38934389-38934411 ACTGTGACTGTATTCGGAGATGG + Intergenic
1179194683 21:39153987-39154009 AGTGTAACAGTATTAGGAGGTGG + Intergenic
1179344277 21:40542456-40542478 ACTGTGATTGTATTAGGAGGTGG + Intronic
1180045590 21:45303686-45303708 AGTGGGACTGGATTTGGAGGTGG + Intergenic
1180106711 21:45623423-45623445 AATGGGACTGTATCAGGAGATGG + Intergenic
1180720960 22:17908086-17908108 ACTGGAACTGTATTGGAAGGTGG + Intronic
1180857560 22:19058041-19058063 ACTGCTGCTGTCTTAGGAGGGGG - Intronic
1182014624 22:27029510-27029532 ACTTGGACTCTATGAGGAGGAGG - Intergenic
1182309764 22:29396219-29396241 ACTGCAACAGTGTTAGGAGGTGG + Intronic
1182817624 22:33179886-33179908 ACTGTGACAGTATTAAGAGGTGG + Intronic
1183022178 22:35036182-35036204 AATGCAACTGTGTTGGGAGGTGG + Intergenic
1183134641 22:35874876-35874898 CCTGTACCTGTATTAGGAGATGG + Intronic
1184904456 22:47471331-47471353 AATGTAATAGTATTAGGAGGTGG - Intronic
1185005101 22:48271196-48271218 AATGTAATGGTATTAGGAGGTGG - Intergenic
1185162128 22:49236425-49236447 AATGGAACTGTATTTGGAGACGG - Intergenic
949229609 3:1735151-1735173 ACAGGAGTTGTATTAGGTGGAGG - Intergenic
949678166 3:6482032-6482054 ATTGTAACAGTATTAAGAGGTGG + Intergenic
949904204 3:8844849-8844871 AATGCAACAGTATTAAGAGGTGG + Intronic
950689207 3:14642239-14642261 ATTGTAACAGTATTAAGAGGTGG + Intergenic
951179281 3:19640097-19640119 ACTGTAACACTATTAAGAGGTGG + Intergenic
951278121 3:20714387-20714409 ACTGTAACAGTATTACGAGATGG - Intergenic
951470968 3:23055577-23055599 ACTGCAAGAGTATTAGGAGGTGG - Intergenic
951552181 3:23885266-23885288 AATGTGACGGTATTAGGAGGTGG - Intronic
951732840 3:25829621-25829643 AGTGTAACAGTATTAGGAAGCGG + Intergenic
951891118 3:27569013-27569035 AATGCAACAGTATTAAGAGGTGG + Intergenic
952428514 3:33199829-33199851 ATTGTAACAGTATTAAGAGGTGG + Intronic
953367925 3:42362685-42362707 AATGTAATGGTATTAGGAGGTGG - Intergenic
955923004 3:63977663-63977685 TCTGGAAATGGATTAGGGGGTGG + Intronic
956054268 3:65281790-65281812 AATGCAACAGTATTAGGAAGTGG + Intergenic
956140073 3:66137734-66137756 CTAGGAACTGTATTAGGAGTTGG - Intronic
956453369 3:69395964-69395986 AATGGAACTGTTTTAGGGTGAGG - Intronic
957496051 3:80992487-80992509 AATGCAACAGTATTGGGAGGTGG - Intergenic
958030704 3:88105846-88105868 ATTGTAACAGTATTAAGAGGTGG + Intronic
958196073 3:90244206-90244228 AATGGAACAGTGTTGGGAGGTGG - Intergenic
958419267 3:93912849-93912871 AATGGAACAGTGTTGGGAGGTGG - Intronic
958778198 3:98510524-98510546 ATTGTAACACTATTAGGAGGTGG + Intronic
959135153 3:102409382-102409404 ACTGTAACAGTATTAAGAGGTGG - Intronic
959410752 3:106018107-106018129 AGTGCAATTGTATTAAGAGGTGG + Intergenic
959417000 3:106087484-106087506 ACTGTGATGGTATTAGGAGGTGG - Intergenic
959950399 3:112174740-112174762 ACTGCAACTGTAGTAGCAGAGGG + Intronic
960137548 3:114121307-114121329 AATGCAACAGTATTAAGAGGTGG + Intergenic
960268322 3:115647074-115647096 ACTGAGATAGTATTAGGAGGTGG + Intronic
960289650 3:115868038-115868060 ACTGTAACTATATTAGGACTAGG - Intronic
960931542 3:122855919-122855941 ACTAAAAATGTATCAGGAGGTGG - Intronic
961167041 3:124770523-124770545 ACTGGAAATGTTTTAGTAGCTGG - Intronic
961892536 3:130142509-130142531 ACTGGAATTATATCAGGAGCTGG + Intergenic
962607637 3:137045683-137045705 AAGGGGACAGTATTAGGAGGTGG - Intergenic
962611523 3:137081221-137081243 ATTGTAACAGTATTAAGAGGTGG + Intergenic
962654605 3:137530547-137530569 AGTGGGAAGGTATTAGGAGGTGG - Intergenic
962809766 3:138950118-138950140 ACTGGAACCGTATCCGCAGGCGG - Intronic
962897602 3:139730275-139730297 AGTGTAACAGTATTGGGAGGTGG + Intergenic
963347718 3:144115847-144115869 AATGCAACAGTGTTAGGAGGTGG + Intergenic
963670666 3:148248170-148248192 ACTGAAAAGCTATTAGGAGGTGG + Intergenic
963987858 3:151617757-151617779 AGTGTAACAGTATTAAGAGGTGG + Intergenic
964954017 3:162329800-162329822 ATTGTAACTGTATTAAAAGGTGG - Intergenic
965295639 3:166942696-166942718 ACTGGAGCTGTAATAGGAGATGG - Intergenic
965653409 3:170957570-170957592 ACTGTAACAGTATAAAGAGGTGG + Intergenic
966183375 3:177206708-177206730 AATGGTATGGTATTAGGAGGTGG - Intergenic
966393340 3:179475887-179475909 ACTGTGACAGTATTAAGAGGTGG - Intergenic
966493561 3:180555299-180555321 AGTGCAACAGTGTTAGGAGGTGG + Intergenic
967013131 3:185457592-185457614 AAAGGGACAGTATTAGGAGGTGG - Intronic
967371589 3:188752684-188752706 ACTGGAACTTTAATATGAGGCGG - Intronic
967720532 3:192811350-192811372 TCTGGAACTGTAGTGGGTGGGGG + Intronic
968716527 4:2163943-2163965 ACAGGAACTGTTTATGGAGGGGG - Intronic
969350514 4:6595675-6595697 ATTGTGACTGTATTAAGAGGTGG - Intronic
969430116 4:7148997-7149019 AATGAGACTGTATTTGGAGGCGG + Intergenic
969440544 4:7214212-7214234 AATGTAACAGTATTGGGAGGTGG + Intronic
969630309 4:8332142-8332164 AATGGGATTGCATTAGGAGGTGG + Intergenic
969750227 4:9104633-9104655 ACTGGAATTATATCAGGAGCTGG - Intergenic
969987795 4:11229640-11229662 AGTGGGATGGTATTAGGAGGTGG - Intergenic
970212287 4:13722124-13722146 ATTGTAACAGTATTAAGAGGTGG + Intergenic
971209923 4:24606241-24606263 ATTGTAACAGTATTTGGAGGTGG - Intergenic
971435417 4:26617287-26617309 ATTGTAACAGTATTAAGAGGTGG - Intronic
971546692 4:27895304-27895326 ATTGCAGCAGTATTAGGAGGTGG - Intergenic
971614584 4:28771485-28771507 AATGTAATGGTATTAGGAGGTGG - Intergenic
971795523 4:31222153-31222175 ACTGTGACTGTATTTGGAGATGG - Intergenic
972161590 4:36234417-36234439 AAGGGAATTGTATTAAGAGGTGG - Intronic
972271461 4:37514293-37514315 ATTGTAACAGTATTAAGAGGTGG - Intronic
973207472 4:47576273-47576295 ACTGTGACAGTGTTAGGAGGTGG - Intronic
974011292 4:56609633-56609655 AGTGCAACAGTATTAAGAGGTGG + Intergenic
974115957 4:57579223-57579245 AGTGTAATGGTATTAGGAGGTGG - Intergenic
976415235 4:84765803-84765825 ATTGGAACTGTATTAGGTATGGG - Exonic
977186941 4:93950757-93950779 ATTGCAACAGTATTGGGAGGTGG + Intergenic
977529234 4:98180728-98180750 ATTGTAACAGTATTAAGAGGTGG + Intergenic
978161794 4:105557514-105557536 AATGTGACAGTATTAGGAGGTGG + Intronic
978868557 4:113545970-113545992 ACTGGAACTTTAATAGGACATGG - Intronic
979080240 4:116329728-116329750 AATGGAATAGTATTAAGAGGTGG + Intergenic
979435736 4:120687685-120687707 ATTGTAACAGTATTAAGAGGTGG + Intronic
979446513 4:120820122-120820144 AATGGAATTGTATTAAGAGGTGG + Intronic
979526331 4:121721332-121721354 AATGCAACAGTATTAAGAGGTGG + Intergenic
980119407 4:128712262-128712284 AATGTAACAGTATTAAGAGGTGG - Intergenic
981857462 4:149311417-149311439 AATGTAATTGTATTGGGAGGTGG - Intergenic
982495228 4:156083080-156083102 ATTGTAACAGTATTAAGAGGTGG + Intergenic
983058024 4:163122656-163122678 ACTGTAACAGTATTAAGAGATGG + Intronic
984275870 4:177608513-177608535 AATGTAACAGTATTGGGAGGTGG + Intergenic
985135954 4:186786300-186786322 AATGCAACAGTATTAAGAGGTGG - Intergenic
986001531 5:3634454-3634476 AATGTAACTGTATTTGGAGATGG + Intergenic
987260019 5:16194033-16194055 ACTGGGATAGTATTAAGAGGTGG - Intergenic
987425066 5:17763650-17763672 AATGCAACAGTATTGGGAGGTGG + Intergenic
987863505 5:23513294-23513316 ATTGTAACAGTATTAAGAGGTGG + Intronic
988052518 5:26049338-26049360 ATTGTAACAGTATTAAGAGGTGG - Intergenic
988326446 5:29774619-29774641 AATGCAACAGTATTTGGAGGTGG + Intergenic
989348595 5:40458054-40458076 ATTGGAACAGAATTATGAGGTGG + Intergenic
990022339 5:51143062-51143084 AATGCAACAGTATTAAGAGGTGG + Intergenic
990766967 5:59194876-59194898 ATTGCAACAGTATTAAGAGGTGG + Intronic
990802300 5:59618755-59618777 ATTGTAACAGTATTAAGAGGTGG + Intronic
991152689 5:63389448-63389470 ACAGAAATTGTGTTAGGAGGTGG - Intergenic
991568087 5:68025875-68025897 AATGCAACTGTGTTGGGAGGTGG - Intergenic
992092573 5:73331277-73331299 ACTGTAACAGTATTAAGAGATGG + Intergenic
992357378 5:75999974-75999996 AATGCAACAGTATTAAGAGGTGG - Intergenic
992817726 5:80462061-80462083 AATGTAACTGTATTTGGAGTTGG - Intronic
993938439 5:94030697-94030719 AATGTAACAGTATTGGGAGGTGG + Intronic
994419267 5:99512443-99512465 AATGGAAGTGTATTATGTGGGGG + Intergenic
994740671 5:103614015-103614037 TGTGGAACTGTAATAGGATGTGG + Intergenic
994875170 5:105413158-105413180 AGTGTAATGGTATTAGGAGGTGG - Intergenic
995956583 5:117783989-117784011 ACTGAATCTGTGTTAGGAAGGGG + Intergenic
996219187 5:120909198-120909220 AATGGGATGGTATTAGGAGGTGG - Intergenic
996357751 5:122615564-122615586 ATTGCAACAGTATTGGGAGGTGG + Intergenic
997939253 5:138142034-138142056 AGTGCAACAGTATTAAGAGGTGG + Intronic
998485900 5:142501950-142501972 AATGCAACAGTATTAAGAGGTGG + Intergenic
999430864 5:151524375-151524397 AGTGTAACAGTATTTGGAGGTGG + Intronic
999706948 5:154282281-154282303 AGTGCAACAGTATTGGGAGGTGG - Intronic
1000284068 5:159811413-159811435 AAGGCAACGGTATTAGGAGGTGG + Intergenic
1001615515 5:173040608-173040630 AATGGAAATGAATTAGGAGAAGG + Intergenic
1003945323 6:11070248-11070270 ACCGTAACAGTATTAAGAGGTGG - Intergenic
1004085255 6:12441467-12441489 ACTGGTATTGTTATAGGAGGAGG + Intergenic
1004337768 6:14780036-14780058 AATGTAACAGTATTAAGAGGCGG + Intergenic
1005726124 6:28650535-28650557 AGTGCAACTCTATTTGGAGGAGG - Intergenic
1005900019 6:30209410-30209432 AATGTAACGGTATTAAGAGGTGG + Intronic
1007042668 6:38738715-38738737 TCTAGAACTATGTTAGGAGGAGG + Intronic
1008630797 6:53361297-53361319 CCTAGAACTAAATTAGGAGGCGG - Intergenic
1008722161 6:54368005-54368027 ATTGCAATGGTATTAGGAGGTGG - Intronic
1008809446 6:55476857-55476879 TCAGGAAATGAATTAGGAGGGGG + Intronic
1009341624 6:62561823-62561845 ATTGCAACAGTATTAAGAGGTGG + Intergenic
1010087703 6:71939765-71939787 ATTGTAACAGTATTAAGAGGTGG - Intronic
1010914098 6:81594679-81594701 AGTGTAATAGTATTAGGAGGTGG + Intronic
1011074691 6:83425925-83425947 AATGCAACTGTGTTAAGAGGTGG + Intronic
1011927848 6:92670629-92670651 AATGGAACAGCATTGGGAGGTGG + Intergenic
1011968115 6:93186014-93186036 AATGCAATTGTATTAGGAGATGG + Intergenic
1012411364 6:98961777-98961799 ATTGTAACAGTATTAAGAGGTGG + Intergenic
1012601637 6:101105653-101105675 AGTGGAATTGTATTAATAGGTGG + Intergenic
1013063565 6:106660928-106660950 ACTGAAACAGTATTAAGAGATGG - Intronic
1013432261 6:110065497-110065519 ACTGGTTATGTAGTAGGAGGGGG + Intergenic
1013607656 6:111765259-111765281 AATGTAACTGTATTTGGAGAAGG + Intronic
1013805315 6:113989931-113989953 TGTGGAACTGGAGTAGGAGGAGG + Intronic
1014503636 6:122225964-122225986 AATGCAACAGTGTTAGGAGGTGG - Intergenic
1014559022 6:122868480-122868502 AATGCAACAGTATTGGGAGGTGG + Intergenic
1016011540 6:139142251-139142273 AGTGCAACAGTATTATGAGGTGG - Intronic
1016563502 6:145424639-145424661 ATTGGGATGGTATTAGGAGGTGG + Intergenic
1016895874 6:149051903-149051925 AATGGAACTCTATTAGGGAGGGG + Intronic
1017538750 6:155377696-155377718 ATTGTAACAGTATTAAGAGGTGG + Intergenic
1018269966 6:162066474-162066496 AATGCAACAGTGTTAGGAGGGGG + Intronic
1019100860 6:169628065-169628087 ACTGCAATGGTATTAAGAGGTGG + Intronic
1019767453 7:2862387-2862409 ACTAGTACTGTATTAGTTGGGGG - Intergenic
1020322748 7:6952012-6952034 ACTGGAATTATATCAGGAGCTGG + Intergenic
1022225211 7:28355796-28355818 ACTGGAAATGTAATAAGAGGAGG + Intronic
1022267907 7:28775848-28775870 ACTGGAACTGTGCTAGGCAGAGG - Intronic
1022317687 7:29260773-29260795 ACCGGACCTGTTTTATGAGGTGG + Intronic
1022829489 7:34051218-34051240 AATGTAATGGTATTAGGAGGTGG - Intronic
1022866752 7:34429675-34429697 AATGCAACAGTATTAAGAGGTGG + Intergenic
1022904588 7:34843461-34843483 ATTGTAACAGTATTGGGAGGTGG - Intronic
1023247684 7:38223084-38223106 CCAGGTACTGTATTAGGTGGTGG - Intronic
1024039136 7:45536156-45536178 ACTGGAAATGTCCTTGGAGGTGG + Intergenic
1024658807 7:51474113-51474135 AATGGGACTGTATTTGGAGATGG - Intergenic
1025963835 7:66249093-66249115 AATGTGACTGTATTAGGAGATGG - Intronic
1027289044 7:76682887-76682909 GCAGGAACTGTACTAGGAGAAGG + Intergenic
1028863394 7:95680109-95680131 ACTTGAACAGTATTGGGAGTGGG - Intergenic
1030255703 7:107507041-107507063 ACTGGAACTGATTTAGGAAGTGG - Intronic
1030569216 7:111201408-111201430 ACTGCAATAGTATTAAGAGGTGG + Intronic
1031006787 7:116482579-116482601 AATGTAATGGTATTAGGAGGTGG - Intronic
1033059941 7:138096504-138096526 AGTGCAACTGTGTTGGGAGGTGG - Intronic
1033070075 7:138194011-138194033 ACAGGAACTGTTTTACCAGGTGG + Intergenic
1033552608 7:142461692-142461714 AGTGGAATGGTATTGGGAGGTGG + Intergenic
1033706609 7:143892700-143892722 AATGGAATGGTATTAGGAAGTGG + Intronic
1034374502 7:150630460-150630482 TCTGGAACTGTTCTGGGAGGTGG + Intronic
1035357307 7:158283953-158283975 CCTGGAAATGTTTTAGGAGCAGG - Intronic
1035394557 7:158526615-158526637 AATGGGACTGTATTTGGAGATGG + Intronic
1035521408 8:277518-277540 AGTGGGATGGTATTAGGAGGTGG + Intergenic
1036373306 8:8178967-8178989 ACTGGAATTATATCAGGAGCTGG - Intergenic
1036589765 8:10158184-10158206 AATGTGACAGTATTAGGAGGTGG - Intronic
1036877602 8:12486674-12486696 ACTGGAATTATATCAGGAGCTGG + Intergenic
1037002416 8:13736353-13736375 ATTGCAACAGTATTGGGAGGTGG + Intergenic
1038558720 8:28549260-28549282 AATGTGACTGTATTTGGAGGTGG - Intronic
1038887778 8:31684242-31684264 AATGTAACAGTATTAAGAGGTGG + Intronic
1040651628 8:49455615-49455637 AAGGCAACTGTATTAGGAGATGG + Intergenic
1040781117 8:51110621-51110643 ACAGTAACGGTATTAGGAAGTGG + Intergenic
1041242683 8:55861725-55861747 AGTGTAATGGTATTAGGAGGTGG - Intergenic
1041630981 8:60086673-60086695 ACTGTGATGGTATTAGGAGGTGG - Intergenic
1041731375 8:61066590-61066612 AGTAGAAATGTATTGGGAGGAGG - Intronic
1044059315 8:87614951-87614973 AGTGGGATGGTATTAGGAGGTGG + Intronic
1044303028 8:90607414-90607436 ATTGTAACAGTATTAAGAGGTGG + Intergenic
1044697325 8:94936370-94936392 TCTGGAACTGTGTGAGGAGCTGG + Intronic
1044928593 8:97230579-97230601 AATGGAACAGCATTGGGAGGTGG + Intergenic
1046283322 8:112062167-112062189 AATGTAACAGTATTGGGAGGTGG + Intergenic
1046616308 8:116481294-116481316 ACTGTGACGGTATTAGGAGGTGG - Intergenic
1046646039 8:116786674-116786696 ACTGTAACACTATTAGAAGGAGG + Intronic
1047064298 8:121263260-121263282 ATTGTAACAGTATTAAGAGGTGG + Intergenic
1047185666 8:122630927-122630949 AGTGCAACAGTATTGGGAGGTGG - Intergenic
1047586606 8:126280371-126280393 ACTGGAACAGGGTTGGGAGGAGG - Intergenic
1047935231 8:129769703-129769725 ATTGTAACAGTATTAAGAGGTGG - Intronic
1048130335 8:131689203-131689225 ATTGGAAAGGTATTAAGAGGTGG + Intergenic
1049881938 8:145070940-145070962 ACTGGAATTATATTAGGAGCTGG + Intergenic
1050095184 9:2057376-2057398 AATGTAATGGTATTAGGAGGTGG - Intronic
1050803012 9:9639015-9639037 AATGCAACAGTATTGGGAGGTGG - Intronic
1051944881 9:22555932-22555954 AGTGCAATGGTATTAGGAGGTGG + Intergenic
1052417129 9:28190431-28190453 AGTGTAATGGTATTAGGAGGTGG + Intronic
1052437516 9:28447246-28447268 AATGCAACAGTATTAAGAGGTGG + Intronic
1053049304 9:34945542-34945564 ATTGTGACGGTATTAGGAGGTGG + Intergenic
1053219388 9:36299312-36299334 AATGCAACAGTGTTAGGAGGTGG - Intronic
1053265516 9:36710337-36710359 ACTGGAATTTTATTAGGTGGGGG - Intergenic
1053375327 9:37601159-37601181 AATGCAACAGTATTAGGAGGTGG - Intronic
1055727792 9:79250197-79250219 ACTGCAACAGTATTGGGAGATGG - Intergenic
1056388825 9:86121599-86121621 AATGTGACTGTATTTGGAGGTGG - Intergenic
1056548917 9:87635530-87635552 AATGGACCAGTTTTAGGAGGAGG + Intronic
1056653990 9:88494521-88494543 ACAGGAAGTGGATTAGCAGGGGG + Intergenic
1057464861 9:95303749-95303771 AATGGGACTGTATTTGGAGATGG - Intronic
1058048244 9:100380334-100380356 AATGTGACAGTATTAGGAGGTGG - Intergenic
1059231850 9:112727918-112727940 AATGTAACAGTGTTAGGAGGTGG - Intergenic
1059288688 9:113201488-113201510 AGTGTGACAGTATTAGGAGGTGG + Intronic
1059607998 9:115857319-115857341 AGTGCAACAGTATTGGGAGGTGG - Intergenic
1062261984 9:135667430-135667452 AGTGGAGCTGTCTTAGGATGAGG + Intergenic
1185602058 X:1346917-1346939 AATGGGACTGTATTTGGAGCTGG - Intronic
1185920825 X:4090232-4090254 AGTGGGATGGTATTAGGAGGTGG + Intergenic
1186095982 X:6102329-6102351 AACGGGACAGTATTAGGAGGTGG + Intronic
1186204573 X:7187880-7187902 ACTGGAATTTCATTTGGAGGGGG + Intergenic
1186211423 X:7254091-7254113 AATGGGATTTTATTAGGAGGTGG - Intronic
1187633041 X:21196072-21196094 AATGCAACAGTTTTAGGAGGTGG + Intergenic
1187873430 X:23783286-23783308 ACTTGAACAGTAGGAGGAGGTGG - Exonic
1187930696 X:24291214-24291236 ATTGCCACTGTATTAAGAGGTGG - Intergenic
1188063523 X:25629593-25629615 ACTGGAACTGAATCAGTTGGGGG + Intergenic
1188128231 X:26398192-26398214 ACTGTAACAGTATTAAAAGGTGG + Intergenic
1188128495 X:26400313-26400335 ATTGTAACAGTATTAAGAGGTGG + Intergenic
1188760402 X:34021284-34021306 ATTGTAACAGTATTAAGAGGTGG - Intergenic
1190140000 X:47834651-47834673 ATTGTAACAGTATTAGGAGGTGG + Intergenic
1190326041 X:49207372-49207394 ACTGGGCATGTATTAGGAGTGGG + Intronic
1192348049 X:70328458-70328480 AATGCAATAGTATTAGGAGGTGG - Intronic
1193238184 X:79134160-79134182 AATGTGACTGTATTTGGAGGTGG - Intergenic
1194675951 X:96793734-96793756 AATGTGATTGTATTAGGAGGTGG - Intronic
1194740305 X:97564626-97564648 ACTGTAGCTGTATTAAGAGGTGG - Intronic
1194762305 X:97809364-97809386 AATGCAACAGTATTGGGAGGTGG - Intergenic
1195835348 X:109108763-109108785 TCTTGAACTGGATCAGGAGGGGG + Intergenic
1196931309 X:120684503-120684525 AATGTAATAGTATTAGGAGGTGG - Intergenic
1197443146 X:126514545-126514567 AATGTGACTGTATTTGGAGGTGG - Intergenic
1197681031 X:129385461-129385483 ACTGGGACTTTTTTTGGAGGGGG - Intergenic
1199287405 X:146068907-146068929 ACTGAAACTTTATTTGGCGGGGG - Intergenic
1199526513 X:148798309-148798331 ACTGTAACAGTATTCAGAGGTGG - Intronic
1200067041 X:153508877-153508899 GCTGGAAATGCATGAGGAGGAGG - Exonic
1200354816 X:155537494-155537516 ACTGGAATGGTAATAAGAGGTGG - Intronic
1200948596 Y:8869818-8869840 ACTGGAATTATATCAGGAGCTGG - Intergenic
1201577244 Y:15474294-15474316 ACTGGAACTTCATTTGGAAGGGG + Intergenic