ID: 1155266899

View in Genome Browser
Species Human (GRCh38)
Location 18:24103080-24103102
Sequence CAACAGAGTGAGACCGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1068
Summary {0: 1, 1: 23, 2: 105, 3: 270, 4: 669}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155266893_1155266899 8 Left 1155266893 18:24103049-24103071 CCGTGATCACGCCACTGCATTCC 0: 58
1: 1686
2: 25750
3: 93283
4: 143998
Right 1155266899 18:24103080-24103102 CAACAGAGTGAGACCGTGTCTGG 0: 1
1: 23
2: 105
3: 270
4: 669
1155266896_1155266899 -3 Left 1155266896 18:24103060-24103082 CCACTGCATTCCAACCTGGGCAA 0: 134
1: 6411
2: 83513
3: 193116
4: 232458
Right 1155266899 18:24103080-24103102 CAACAGAGTGAGACCGTGTCTGG 0: 1
1: 23
2: 105
3: 270
4: 669

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155266899 Original CRISPR CAACAGAGTGAGACCGTGTC TGG Intronic
900544514 1:3220992-3221014 CAAGAGAGGGAGACCCTGTCTGG + Intronic
900653686 1:3744438-3744460 CGACAGAGTGAGACTCCGTCAGG + Intergenic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
901385313 1:8904424-8904446 CAACAGAGCGAGACCCTGTGAGG - Intergenic
901502431 1:9661406-9661428 CAACAGAATGAGACCCTATAAGG - Intronic
901567010 1:10125104-10125126 CGACAGAGTGAAATTGTGTCTGG + Intronic
901650635 1:10740936-10740958 CGACAGGGTGAGACCCTGTCTGG + Intronic
901693936 1:10992479-10992501 CAACAGAGTGAGACTTCGTGGGG + Intergenic
901805291 1:11735020-11735042 CGACAGGGTGAGACCTTGTCTGG - Intergenic
902464718 1:16608961-16608983 CAACATAGTAAGACCCCGTCTGG + Intronic
902507527 1:16947856-16947878 CAACAGAGCAAGACTCTGTCTGG - Intronic
902910226 1:19590587-19590609 CAACAGAGTGATACTCTGTCTGG + Intergenic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903202545 1:21754139-21754161 CAACAGAGTGAGACTCCATCTGG + Intronic
903303839 1:22398475-22398497 TGACAGAGTGAGACCCTGTCTGG + Intergenic
903520395 1:23943070-23943092 TGACAGAGTGAGACTCTGTCTGG + Intergenic
903552713 1:24169233-24169255 CAACAGCGAGGGACCATGTCTGG - Intronic
903873639 1:26456350-26456372 CAACAGAGGGAGACCCTGTCTGG + Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
903986136 1:27230422-27230444 ACACAGAATGAGACCCTGTCTGG - Intergenic
904065122 1:27743743-27743765 CAACAGAGCAAGACCCTGTTTGG + Intronic
904136566 1:28317135-28317157 AAAGAGAGTGAGAATGTGTCAGG - Intergenic
904137859 1:28327991-28328013 CAACAGAGGGAGATCCTGTCTGG - Intergenic
904147678 1:28407142-28407164 CAACAGCCTGAGACTGTGCCAGG - Intronic
904641441 1:31933701-31933723 CAACAGAGTAAGACTCTGTCTGG + Intronic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
905039590 1:34944506-34944528 TGACAGAGTGAGATCATGTCTGG + Intergenic
905080560 1:35315904-35315926 TGACAGAGTGAGTCCCTGTCTGG + Intronic
905844153 1:41212854-41212876 CAACAAAGTGAGACTCTGTCTGG + Intronic
906031555 1:42724285-42724307 CGACAGAGTGAGACTGTCTCAGG + Intergenic
906246460 1:44278455-44278477 CAACAGAGCAAGACTGTCTCAGG + Intronic
906337051 1:44942445-44942467 TGACAGAGTAAGACCCTGTCTGG - Intronic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906439753 1:45831008-45831030 CGACAGAGTGAGACCTTGTCTGG + Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
907049409 1:51319708-51319730 TGACAGAGTGAGACTCTGTCTGG - Intronic
907130422 1:52092614-52092636 CGACAGAGTGAGATTGTCTCAGG - Intergenic
907536242 1:55161350-55161372 CAACAGAGCGAGACTCTGTCTGG + Intronic
908326141 1:63025638-63025660 CAACAGAGTGAGACCCTTGTTGG - Intergenic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
908777135 1:67650921-67650943 CGACAGAGTAAGACTCTGTCTGG + Intergenic
909000410 1:70210693-70210715 CAACAGAGCGAGACCCTGTAGGG + Intronic
909620491 1:77661834-77661856 CAACAGAGCAAGACCTCGTCTGG - Intronic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
909834861 1:80241016-80241038 CAATATAATGAGACCCTGTCTGG + Intergenic
911080437 1:93923808-93923830 TGACAGAGTGAGACCCTGTCTGG + Intergenic
912422762 1:109556953-109556975 CAACAGAGTGAGACTGTCTCGGG - Intronic
912651723 1:111445786-111445808 CAACAGAGTGAAACTGTCTCAGG - Intronic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
912987905 1:114453342-114453364 CAACAGAGAGAGTCTGTCTCAGG + Intronic
913468117 1:119163940-119163962 CAGCAGATTGAGACCATGCCGGG - Intergenic
913997371 1:143662200-143662222 CAACAGAGCGAGACTCCGTCTGG - Intergenic
914413499 1:147455385-147455407 CAACAGAGCAAAACCCTGTCTGG + Intergenic
914673602 1:149890614-149890636 TGACAGAGTGAGACTCTGTCTGG - Intronic
914760604 1:150595377-150595399 CGACAGAGTGAGACCTGGTCTGG + Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
914943486 1:152043208-152043230 CAACAGAGGGAAACCCTGTCTGG + Intronic
915139633 1:153759252-153759274 CAACAGAGCAAGACCCTGTCTGG + Intronic
915150256 1:153825066-153825088 CAACAGAGTGAGACCTTGTCAGG + Intronic
915186797 1:154112834-154112856 CAACAGAATGAGACCCTGTCTGG + Intronic
915295276 1:154916867-154916889 CAACATAGTGAGACCTTGTCTGG - Intergenic
915426290 1:155829968-155829990 CCACAGAGCGAGACTCTGTCTGG - Intronic
915492171 1:156256944-156256966 CGACAGAGCGAGACTCTGTCTGG - Intronic
915841042 1:159213210-159213232 CGACAGAGTGAGACCTTGTCTGG + Intergenic
916141440 1:161702690-161702712 TGACAGAGTGAGACTCTGTCTGG + Intergenic
916228434 1:162514267-162514289 CAACAGAGTGAGACCATCTCTGG + Intronic
916710811 1:167405665-167405687 GAACAGAGCGAGACCCTGTTTGG + Intronic
917289354 1:173456417-173456439 CAACGGAGTGAGAACCTGACTGG - Intergenic
917910293 1:179637693-179637715 CAACAGAGTAAGGCCCTGTCTGG + Intronic
917938044 1:179888433-179888455 CAACATACTGAGACCCTGTCTGG - Intronic
918025379 1:180739758-180739780 AAACATAGTGAGACCCTGTCTGG - Intronic
918670025 1:187203335-187203357 CAACAGAGCAAGACTGTGTCTGG - Intergenic
918833191 1:189425202-189425224 CTACAGAGAGAGAGCCTGTCTGG - Intergenic
919288527 1:195598426-195598448 CAACAGAGCAAGACTCTGTCAGG - Intergenic
919700510 1:200626694-200626716 CAACAGAGCAAGACTGTCTCGGG + Intronic
919975984 1:202613098-202613120 CGACAGAGCGAGACTCTGTCTGG - Intronic
920120703 1:203654865-203654887 TGACAGAGTGAGACCTCGTCTGG + Intronic
921782323 1:219180014-219180036 CAACAGAGTGAGACTCTGTCTGG - Intronic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
922571137 1:226635238-226635260 CGACAGAGTAAGACCCTGTCTGG - Intronic
922643291 1:227258153-227258175 CAACAGGGTGAAACCCTGTCCGG + Intronic
922731663 1:227951743-227951765 CAACAGAGTGAGACTCTGTCTGG + Intergenic
923072443 1:230577926-230577948 CAACAGAACAAGACCTTGTCTGG - Intergenic
923157828 1:231293969-231293991 CAACAGAGTGAGACTCTGTCTGG + Intergenic
924090949 1:240500316-240500338 CAACAGAGCAAGACTCTGTCTGG - Intronic
924177840 1:241410950-241410972 CAGAAGAATGTGACCGTGTCTGG - Intergenic
924213202 1:241791650-241791672 CGAAAGAGTGAGACCCTGTCTGG + Intronic
924237887 1:242014431-242014453 CAACAGAGCAAGACCCTGTCTGG - Intergenic
924559596 1:245146759-245146781 CAACAGAGTGAGAGGGAGCCAGG - Intergenic
924704337 1:246487438-246487460 CAACAGAGCAAGACTCTGTCTGG + Intronic
924795216 1:247287924-247287946 CAGAAGACTGAGACCGTATCTGG + Intergenic
924918430 1:248599168-248599190 CGACAGAGCGAGACTCTGTCTGG + Intergenic
924943591 1:248829775-248829797 CATCAGAGGGAGACCGTGCAGGG - Intergenic
1062947625 10:1473400-1473422 CAACAGAGTGAGGCCCTGTCAGG - Intronic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1063108799 10:3017383-3017405 CAGCAGAGTGAGACTCTGTTTGG + Intergenic
1063132361 10:3189191-3189213 CAACAGAGAGAGGCCCTGTCAGG - Intergenic
1063158434 10:3401019-3401041 CAACAAAGTGAGACTCTGTCTGG + Intergenic
1063237015 10:4127459-4127481 CAACAGAGCAAGACTCTGTCTGG + Intergenic
1064040294 10:11956838-11956860 TGACAGAGTGAGACTGTGTCTGG - Intronic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1064112958 10:12554175-12554197 CAACAGAGCGAGATTCTGTCAGG - Intronic
1064180642 10:13111674-13111696 CGACAGAGTGAGACTCTGTCTGG + Intronic
1064706048 10:18073730-18073752 CAACAGAGCGAGACCCTGTCTGG - Intergenic
1064997167 10:21306436-21306458 TGACAGAGTGAGACCCTGTCTGG - Intergenic
1065334961 10:24647855-24647877 GAACAGAGTGAGACTGTCTGGGG - Intronic
1065542678 10:26785703-26785725 CGACAGAGTCAGACTCTGTCTGG + Intronic
1065691328 10:28336741-28336763 TGACAGAGTGAGACTCTGTCTGG + Intergenic
1065715232 10:28560339-28560361 CAACAAAGCGAGATCCTGTCGGG + Intronic
1065914742 10:30344722-30344744 CAATAGAGTGAGACTCTGTCTGG - Intronic
1065925283 10:30429626-30429648 CGACAGAGTGAGACTGTGTCTGG + Intergenic
1066116690 10:32246927-32246949 TGACAGAGTGAGATCGTGTCTGG - Intergenic
1066360254 10:34723272-34723294 CAACAGAGCGAGGCTCTGTCTGG + Intronic
1066423649 10:35285033-35285055 CAACAGAGCAAGACTCTGTCTGG - Intronic
1066589582 10:36979852-36979874 CAACATGGTGAAACCCTGTCGGG + Intergenic
1067260946 10:44690940-44690962 CAACAGAGCAAGACTCTGTCTGG - Intergenic
1068308504 10:55247870-55247892 TGACAGAGTGAGACGCTGTCTGG + Intronic
1068524529 10:58112984-58113006 CAGCATACTGAGACCATGTCTGG + Intergenic
1068596482 10:58907602-58907624 TGACAGAGTGAGATCCTGTCTGG + Intergenic
1068865063 10:61886320-61886342 CACAAGAGTGAGAAGGTGTCAGG - Intergenic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069017417 10:63445892-63445914 AACCAGAGTGAGACTCTGTCTGG - Intronic
1069058619 10:63870655-63870677 AGACAGAGTGAGACCCTGTCTGG - Intergenic
1069099397 10:64299589-64299611 CAACAGCGTGAGACCCTGTCTGG + Intergenic
1070212886 10:74345320-74345342 CAACAAAGCAAGACCCTGTCTGG - Intronic
1070264407 10:74887964-74887986 TGACAGAGTGAGATCCTGTCTGG + Intronic
1071114312 10:82199150-82199172 TGACAGAGTGAGACTCTGTCCGG + Intronic
1071386176 10:85123626-85123648 CAACAAAGGGAGACCATGTTGGG + Intergenic
1071548232 10:86545015-86545037 CAACACAGTGAGACCCTGTCTGG - Intergenic
1071553679 10:86586219-86586241 CCACACAGTGAGAAAGTGTCAGG - Intergenic
1071882963 10:89919175-89919197 CAACAGAGCAAGACTCTGTCTGG + Intergenic
1072095214 10:92171632-92171654 CAACAGAGTGAGACTCTCTCTGG - Intronic
1072341660 10:94458518-94458540 CAACATGGTGAAACTGTGTCTGG + Intronic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1072606715 10:96990185-96990207 CGACAGAGTGAGACCCTGTCTGG - Intergenic
1073141375 10:101250551-101250573 CAACAGAGTGAGACTGTCTCAGG - Intergenic
1073337670 10:102722552-102722574 CGACAGAGTGAGACCCTGTCTGG - Intronic
1073408003 10:103315203-103315225 TGACAGAGTGACACCCTGTCTGG - Intronic
1074215340 10:111378749-111378771 CAACAGAGTGAGACTCCATCTGG - Intergenic
1074347051 10:112697211-112697233 TAACAGAGCAAGACCCTGTCTGG - Intronic
1074956823 10:118399138-118399160 CGACAGAGCGAGACTCTGTCTGG - Intergenic
1075169573 10:120101150-120101172 CAACATAGTGAGACCCTGTGTGG - Intergenic
1075320340 10:121486460-121486482 CAACAGAGCGAGACTCTGTCTGG - Intronic
1077099328 11:814780-814802 CGACAGAGTGAGATCACGTCTGG - Intergenic
1077224485 11:1434198-1434220 CAACAGGGCGAGGCCGAGTCTGG + Intronic
1077434869 11:2534139-2534161 CAGCAAAGTGAGACCCTGTAGGG + Intronic
1077592323 11:3501755-3501777 TGACAGAGTGAGACCCTGTATGG + Intergenic
1077616773 11:3681057-3681079 CAACACCGTGAGACCCTGTCTGG - Intronic
1078125451 11:8557229-8557251 CAACAGAGGGGGACCTTGTGGGG + Intronic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1078245137 11:9567494-9567516 CAACAGAGCAACACCCTGTCTGG - Intergenic
1078297429 11:10088041-10088063 CAACAGAGTGAGACCTTGTCTGG - Intronic
1078676158 11:13416332-13416354 CAACACAGTGAGACCCTGTCTGG + Intronic
1078791422 11:14546455-14546477 CAACAGAGCGAGACTCTGTCTGG - Intronic
1078909168 11:15715002-15715024 CAACATATTAAGACTGTGTCAGG + Intergenic
1079255770 11:18828398-18828420 CAACAGAGCGAGACTCTGTCAGG - Intergenic
1079431749 11:20396616-20396638 CAACAGAGCAAGACTTTGTCGGG + Intronic
1080623090 11:34003931-34003953 TGATAGAGTGAGACCCTGTCTGG + Intergenic
1082047322 11:47740611-47740633 CGACAGAGTGAGACTGTCTCGGG - Intronic
1082859222 11:57838059-57838081 TGACAGAGTGAGACCCTGTCTGG - Intergenic
1083802432 11:65054216-65054238 CAACTGAGGGAGACCTGGTCTGG + Intronic
1083840171 11:65299709-65299731 CGACAGAGTGAGACTCTGTCGGG - Intronic
1083847141 11:65342424-65342446 TAACAGAGGGAGACCCTGTCTGG + Intronic
1084248160 11:67874475-67874497 TGACAGAGTGAGACCCTGTATGG + Intergenic
1084867195 11:72068599-72068621 TGACAGAGAGAGACCCTGTCTGG + Intronic
1085030547 11:73268602-73268624 TGACAGAGTGAGACCCTGTCTGG + Intronic
1085421477 11:76365402-76365424 CGACAGAGTGAGCGCTTGTCTGG - Intronic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1085547338 11:77332292-77332314 TGACAGAGTGAGACCCTGTGGGG + Intronic
1085650502 11:78263611-78263633 CGACAGAGTGAGACTCTGTCTGG + Intronic
1085898497 11:80668180-80668202 CAACATGGTGAAACCCTGTCAGG - Intergenic
1086057110 11:82659505-82659527 CAACAGAGTGAGACTCTGTCAGG + Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1087752287 11:102020061-102020083 CAACAGAGCAAGGCTGTGTCAGG + Intergenic
1088297312 11:108314133-108314155 CAACAGAGCCAGATCCTGTCTGG - Intronic
1088546103 11:110960733-110960755 CAACAGAGAGAGACTCTGTCTGG - Intergenic
1088707049 11:112473163-112473185 CAACAGAGCGAGACTCTGTCTGG + Intergenic
1089249395 11:117146669-117146691 CGACTGACTGAGACCCTGTCGGG + Intronic
1089328713 11:117675315-117675337 CAACAGAGCGAGATCCTGGCTGG - Intronic
1089727562 11:120495992-120496014 CAACAGAGTGAGACTCAGTCAGG - Intergenic
1090811152 11:130244645-130244667 CGACAGAGAGAGACTCTGTCTGG + Intronic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1090984760 11:131756396-131756418 CAACATAGAAAGACCTTGTCTGG + Intronic
1091232224 11:133996076-133996098 TAACAGACTGAGACCCTGTCTGG + Intergenic
1092053911 12:5493256-5493278 CAACAGAATGAGAGCGTGGATGG + Intronic
1092124946 12:6068487-6068509 CAACAGAGCGAGACTGTCTCAGG - Intronic
1092418443 12:8309867-8309889 TGACAGAGTGAGACCCTGTATGG + Intergenic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092466715 12:8739925-8739947 TGACAGAGCGAGACCCTGTCTGG - Intronic
1092522323 12:9287633-9287655 TGACAGAGTGAGACTCTGTCTGG + Intergenic
1092544960 12:9444229-9444251 TGACAGAGTGAGACTCTGTCTGG - Intergenic
1092793094 12:12086296-12086318 TGACAGAGTGAGACTCTGTCTGG + Intronic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1092851780 12:12635347-12635369 TGACAGAGTGAGACCCTGTCTGG + Intronic
1093400098 12:18735423-18735445 TAACATAGTGAGACCCTGTTTGG - Intronic
1093470949 12:19501615-19501637 CTACAAAGTGAGACCCTGTCTGG + Intronic
1093849533 12:24018776-24018798 CAACAGAGTAAGACTCTGTCTGG + Intergenic
1094048549 12:26194968-26194990 CAACACAGTGAGCCCCTGTTTGG + Intronic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1094427895 12:30334740-30334762 CAACAGAGCGAGACTCCGTCTGG + Intergenic
1094534713 12:31310888-31310910 CGACAGAGTGAGACTCTCTCAGG - Intronic
1094564065 12:31583656-31583678 CAACAGAGCAAGACTGTGTCTGG + Intronic
1095887325 12:47202987-47203009 CAACAGAGCCAGACTGTCTCAGG - Intronic
1096160273 12:49370800-49370822 CGACAGAGTGAGATCCTTTCTGG - Intronic
1096162230 12:49388391-49388413 TGACAGAGAGAGACCCTGTCAGG - Intronic
1096347119 12:50859233-50859255 CAACAGAGCAAGACTCTGTCTGG - Intronic
1096623376 12:52878389-52878411 CAACAGAACGAGACCCTGTCTGG + Intergenic
1096940225 12:55336238-55336260 GAACAGAGTCAGACCCTGCCTGG - Intergenic
1097677914 12:62622958-62622980 CAACAGAGCGAGACTCCGTCTGG - Intergenic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1098543933 12:71690173-71690195 CAACAGAGCAAGACTGTCTCGGG - Intronic
1098849698 12:75580813-75580835 CAACAGAGTGAGACTCTGTCTGG + Intergenic
1098970322 12:76847836-76847858 TGACAGAGCGAGACCTTGTCTGG + Intronic
1099355585 12:81630914-81630936 CAACAGAGCTAGACTCTGTCTGG - Intronic
1100222797 12:92524114-92524136 CAACAGAGCAAGACCCTGCCTGG + Intergenic
1100535629 12:95506075-95506097 CGACAGAGTGAGACTTCGTCTGG + Intronic
1100625516 12:96327565-96327587 CAACAGAGCAAGACCCTGCCTGG - Intronic
1100975256 12:100115740-100115762 TGACAGAGTGAGATCCTGTCTGG + Intronic
1100983368 12:100181766-100181788 CAACAGGATGAGACTCTGTCTGG + Intergenic
1101179682 12:102201449-102201471 CGACAGAGCGAGACTCTGTCTGG + Intergenic
1101925567 12:108968811-108968833 CAACAGAGCGAGACTCTGTCTGG - Intronic
1102151379 12:110690772-110690794 CCACAGAGTGAGACTGTTGCCGG - Intronic
1102267685 12:111501909-111501931 CAACGGAGTCAGACCCTGTTTGG - Intronic
1102686014 12:114725273-114725295 CAACAAAGAGAGACCCTGTCTGG - Intergenic
1102905767 12:116674170-116674192 CAACAGAATGAGAACCTATCTGG - Intergenic
1103406587 12:120680151-120680173 CAACAGAGTAAGACTCTGTATGG + Intergenic
1103556476 12:121769681-121769703 TGACAGAGTGAGACCCTGCCTGG + Intronic
1103640355 12:122346520-122346542 TGACAGAGTGAGACTCTGTCTGG - Intronic
1103662971 12:122536537-122536559 CCACAGAGCGAGACTGTCTCAGG - Intronic
1104453403 12:128889792-128889814 CAACGGAATGAGACTCTGTCAGG - Intronic
1104839405 12:131814703-131814725 CAACATATTGAGACCCTGTCTGG + Intergenic
1104869971 12:131988012-131988034 CAACAGAGCAAGACCCTGTCTGG - Intronic
1105435039 13:20369381-20369403 CAACAGAGCGAGACCCTGTCTGG - Intergenic
1106139460 13:26999707-26999729 CAGCAGAGTGTGACCCAGTCGGG + Intergenic
1106275590 13:28202980-28203002 CAACAGAGTGAGACCCTGTCTGG - Intronic
1106601990 13:31196219-31196241 CGACAGAGTGAGATTCTGTCTGG - Intergenic
1106648733 13:31666068-31666090 CAACAGAGTGAGAATCCGTCTGG - Intergenic
1106807161 13:33321484-33321506 CAACAGAGAGACTCCGTCTCAGG + Intronic
1107184194 13:37497849-37497871 CAACAGAGTAAGACTATGTCCGG + Intergenic
1107917203 13:45164704-45164726 TGACAGAGTGAGACCCTGTCTGG + Intronic
1108387903 13:49918561-49918583 CAACATGGTGAAACCGTGTGTGG - Intronic
1108953467 13:56119859-56119881 CAACAGAGCGAGACTCTGTCTGG + Intergenic
1109244629 13:59938587-59938609 CAACAGAGGCAGACCTTGTTTGG + Intronic
1109534472 13:63698449-63698471 CAACAGAGTGAAACCCTGTCAGG + Intergenic
1110198213 13:72815683-72815705 TGACAGACTGAGACCTTGTCTGG - Intronic
1110431267 13:75426854-75426876 CAACATGGGGAGACCCTGTCTGG + Intronic
1110441760 13:75533987-75534009 CAACAGACTGAGATCCTGTCTGG - Intronic
1110566574 13:76963405-76963427 CAACAAAGTAAGACCCTGTCTGG + Intergenic
1110773283 13:79376217-79376239 CAACTGAGCAAGACCCTGTCTGG - Intronic
1111216455 13:85149138-85149160 CAACAGAGCGAGACCCTGACTGG - Intergenic
1111703970 13:91724835-91724857 CGACAGAGTGAGATCCTGTCTGG + Intronic
1111768965 13:92572013-92572035 CAACAGAATGAGCCCCTGTCTGG + Intronic
1111957587 13:94775536-94775558 CAACAGAGTGAGGCCTTGTCAGG + Intergenic
1112763856 13:102719856-102719878 CAACAGAGTAAGACCCTGTCTGG + Intergenic
1113119913 13:106915081-106915103 TGACAGAGCGAGACCCTGTCTGG + Intergenic
1113189374 13:107726627-107726649 CAACAGAGTGAGACTCCATCTGG - Intronic
1113225144 13:108151616-108151638 CAGCAGAGTGAGACCCTGTCTGG + Intergenic
1113723707 13:112581463-112581485 CGACAGAGTGAGACCTTGTCTGG - Intronic
1113850953 13:113417634-113417656 GAACAGCCTGAGACCGTCTCGGG - Intergenic
1114175830 14:20318780-20318802 CGACAGAGTGAGACCCTATCTGG - Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114403212 14:22429373-22429395 CAACTGAGTGAGACAGTTTTTGG - Intergenic
1114446021 14:22788682-22788704 CGACAGAGTGAGACTCTGTCTGG + Intronic
1115233060 14:31182208-31182230 CGACAGAGCAAGACCCTGTCTGG - Intronic
1115273794 14:31584163-31584185 CAACAAAGCAAGACCCTGTCAGG - Intronic
1115581025 14:34758558-34758580 CGACAGAGTGAGACTGTCTCAGG + Intronic
1115632569 14:35260029-35260051 CAACAGAGTGAAACCCTATCTGG - Intronic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1116001598 14:39248757-39248779 CGATAAAGTGAGACCCTGTCTGG - Intronic
1116870789 14:50067655-50067677 CCTCAGAGTGTGACCGTGTGGGG - Intergenic
1116919532 14:50558337-50558359 CAACAGAGGGAGACTGTGTCTGG + Intronic
1116983106 14:51191789-51191811 CAACAGAGTGAGACTGTCTCAGG + Intergenic
1117304133 14:54457094-54457116 CAACAGAGCAAAACCCTGTCTGG + Intergenic
1117361245 14:54976380-54976402 CAACATAGAGAGACCCTGCCAGG - Intronic
1117497220 14:56317836-56317858 AAACAGGGTGAGAACATGTCGGG - Intergenic
1118181533 14:63498575-63498597 TGACAGAGTGAGACCCTGTCTGG - Intronic
1118206159 14:63725352-63725374 CAACAGAGCGAGACTCCGTCAGG + Intronic
1118245061 14:64102134-64102156 CGACAGAGCGAGTCCGTCTCAGG - Intronic
1118263107 14:64266899-64266921 TGACAGAGTGAGACTCTGTCTGG - Intronic
1119054716 14:71407524-71407546 CAACAAAGTGAGACCCTGGGAGG - Intronic
1119193057 14:72697351-72697373 ATACAGGGTGAGACCGTGCCAGG + Intronic
1119458668 14:74779659-74779681 CAACAGAGTGAGACCCTGTCTGG - Intronic
1119548407 14:75490441-75490463 CAACATAGTGAGACTCTGTCTGG - Intergenic
1119815626 14:77564210-77564232 CAACAGAGGGAGACTCTGTCTGG + Intronic
1119839055 14:77777253-77777275 GAACAGAGTCAGACAATGTCTGG + Intergenic
1119951723 14:78752219-78752241 CAACAGGGTGAAACCCTGTTTGG + Intronic
1120628254 14:86856469-86856491 CATCAGAATGTGACCTTGTCTGG + Intergenic
1120679973 14:87469547-87469569 GTACAGAGTGAGACCCTGTGGGG - Intergenic
1121248015 14:92477486-92477508 CAACAGAGTGAGGTCTTGTCTGG - Intronic
1122058436 14:99120882-99120904 CAACATAGAGAAACCCTGTCAGG + Intergenic
1122085564 14:99299562-99299584 AAAAAGAGTGAGACCCTGTCTGG + Intergenic
1122233076 14:100316918-100316940 CAACAGAGCGAGACTCTGTCTGG - Intergenic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1122581613 14:102775401-102775423 CGACAGAGTGAGACTCTGTCTGG - Intergenic
1122608698 14:102965935-102965957 CAACAGAGTGAGACTGTCGCGGG + Intronic
1122672298 14:103382132-103382154 CAAGAGAGCAAGACCCTGTCTGG + Intergenic
1122686770 14:103512253-103512275 CGACAGAGTGACACTCTGTCTGG - Intergenic
1123005585 14:105321380-105321402 TGACAGAGTGAGATCCTGTCTGG - Intronic
1123107445 14:105849226-105849248 CCACAGAATGTGACCTTGTCTGG + Intergenic
1123625591 15:22224872-22224894 TGACAGAGTGAGACCTTGACGGG - Intergenic
1123911112 15:24967786-24967808 CAACAGAATGAGACCCTGTCTGG + Intronic
1123966933 15:25468541-25468563 CGACAGAGTGAGACTCTGTCTGG + Intergenic
1124033214 15:26030003-26030025 CAACAGAGTGAGACACTCTTGGG + Intergenic
1124719520 15:32099263-32099285 CAAGAGACTCAGACCGTGTGTGG + Intronic
1124908087 15:33891081-33891103 CAACAGAGTGAGACTCTGTCTGG + Intronic
1125662808 15:41407630-41407652 CAACAAAGTGAGACTCTGTCTGG - Intergenic
1125785178 15:42309997-42310019 TGACAGAGTGAGACCCTATCTGG + Intronic
1126019590 15:44387161-44387183 CAGCAGAGCAAGACCTTGTCTGG + Intronic
1126030422 15:44491859-44491881 CAAAAGAGCCAGACCCTGTCTGG + Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1126355367 15:47789615-47789637 TGACAGAGTGAGACCCTGTCTGG + Intergenic
1127429263 15:58886284-58886306 CTACAGAGCCAGACCCTGTCTGG - Intronic
1127570156 15:60233863-60233885 CAACAGAGGGAGACTGTCTCAGG + Intergenic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1127615664 15:60683028-60683050 CAACACACTGAGAACCTGTCTGG - Intronic
1127785483 15:62351367-62351389 CCACAGAGTGAGACTCCGTCTGG + Intergenic
1128180649 15:65600600-65600622 TAACAAAGTGAGACCCTGTTTGG + Intronic
1128388658 15:67167971-67167993 CAACAGAGGGAGACTCTGTCTGG - Intronic
1128581156 15:68811040-68811062 CCACAGAGTGAGACTCTGTCTGG + Intronic
1129074354 15:72978933-72978955 TGACAGAGTGAGACCCTGTCTGG + Intergenic
1129145001 15:73639115-73639137 CAACAGAGCGAGACTCTGTCTGG - Intergenic
1129218834 15:74119228-74119250 GGACAGAGTAAGACCCTGTCTGG - Intronic
1129339480 15:74875753-74875775 TGACAGAGTGAGACTTTGTCTGG - Intergenic
1129404909 15:75309960-75309982 GAGCAGAGTGACACCCTGTCTGG + Intergenic
1129827934 15:78647118-78647140 CAACAAAGTGGGACTGTCTCAGG + Intronic
1130111815 15:80971644-80971666 GGACAGAGTGAGACCCTGGCTGG - Intronic
1130165120 15:81448100-81448122 CAACAGAGCGAGACTCTGTCTGG - Intergenic
1130510606 15:84586157-84586179 GGACAGAATGAGACCCTGTCTGG - Intergenic
1131187405 15:90286466-90286488 CAACAGAGTAAGACCATGTTTGG + Intronic
1131809022 15:96153101-96153123 AGTCAGAGTGAGACCCTGTCTGG + Intergenic
1131817419 15:96235664-96235686 AGACAGAGTGAGACCTTGTCTGG + Intergenic
1131912177 15:97219437-97219459 CAACAGAGTGAGACTCTATAGGG - Intergenic
1131949764 15:97669352-97669374 CAACAGAGCAAGACCCTGACTGG - Intergenic
1132104064 15:99050251-99050273 CAACAGAGCCAGACCCTGTTTGG + Intergenic
1132181603 15:99757615-99757637 CAACAGAGTGAACCCCTGTCTGG - Intergenic
1132521533 16:392288-392310 CAACAGGGCGAGACCCGGTCTGG - Intergenic
1132837267 16:1960237-1960259 CAACAGAGTGAGACTGTCTCAGG - Intronic
1133011551 16:2915155-2915177 CAACAAAATGAGACTGTCTCAGG - Intronic
1133105885 16:3509227-3509249 CAACAGAACGAGACCTTGTCTGG + Intronic
1133124447 16:3636798-3636820 CAACAGAGTGAGACTCTGTCTGG + Intronic
1133329240 16:4961346-4961368 CAACAGAGTGAGACTCAGTCTGG - Intronic
1133369468 16:5237125-5237147 CAAGAGAGTGAGACCCTGTCTGG + Intergenic
1133561559 16:6955219-6955241 CAACAGAGTGAGACCTTGTCTGG + Intronic
1133819834 16:9226346-9226368 CAACAGAGCCAGACCCTGTCAGG - Intergenic
1133946638 16:10354590-10354612 TAACAAAGTGAGCCCCTGTCAGG + Intronic
1133979287 16:10621631-10621653 TGACACAGTGAGACCCTGTCTGG + Intergenic
1133987892 16:10682345-10682367 TGACAGAGTGAGACTCTGTCTGG - Intronic
1134014936 16:10881276-10881298 CAACAGAGCAAGACTGTCTCAGG + Intronic
1134068691 16:11247105-11247127 TGACAGAGTGAGACTCTGTCGGG - Intergenic
1134130416 16:11645867-11645889 TGACAGAGTGAGACTCTGTCTGG - Intergenic
1134154947 16:11835511-11835533 CAACAGAGAGAGACAGTCCCTGG - Exonic
1134241625 16:12510974-12510996 CGACAGAGTGAGACTCTGTGGGG - Intronic
1134375975 16:13673619-13673641 CATCAGAGTGAGACCCTGTCAGG + Intergenic
1134448929 16:14351597-14351619 CGACAGAGTGAGACTCTGTCTGG + Intergenic
1134568320 16:15270066-15270088 TGACAGAGTGAGACCCTGGCAGG + Intergenic
1134734111 16:16486294-16486316 TGACAGAGTGAGACCCTGGCAGG - Intergenic
1134744501 16:16577335-16577357 TGACAGAGTGAGACCCTGTCTGG - Intergenic
1134933388 16:18225987-18226009 TGACAGAGTGAGACCCTGGCAGG + Intergenic
1135000986 16:18776417-18776439 TGACAGAGTGAGACCCTGTCTGG + Intergenic
1135035496 16:19073471-19073493 TGACAGAGTGAGACCCTGTCTGG + Intronic
1135036034 16:19077606-19077628 AGACAGAGTGAGACTGTGTCTGG - Intronic
1135108015 16:19667712-19667734 CGACAGAGCAAGACCCTGTCTGG + Intronic
1135697307 16:24601216-24601238 CAACAGAGCTAGACTCTGTCTGG - Intergenic
1135706185 16:24677180-24677202 CAACAGAGCGAGACTCTGTCAGG - Intergenic
1135760791 16:25136567-25136589 CAACAGAGTGAGACTCTGACGGG - Intronic
1136039115 16:27564042-27564064 CAACAGAGCAAGACCCTGTCTGG + Intronic
1136465731 16:30442357-30442379 CAACAGAGTGAGACTTTGTCCGG + Intergenic
1136484909 16:30565449-30565471 CAACATAGTGAGACCCTGTCTGG + Intergenic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1137424860 16:48369700-48369722 CAACAGAGTGAGACCCTGTCTGG + Intronic
1137794403 16:51203129-51203151 CTATAGAGTGAGACCCTGTCAGG - Intergenic
1137797659 16:51235885-51235907 CGACAGAGGGAGACCCTGTCCGG - Intergenic
1138185749 16:54976162-54976184 CAACAGAGCGACACCGTTTCTGG - Intergenic
1138687548 16:58738942-58738964 CAACAGAGTGAGACGCTGTCAGG + Intergenic
1138693102 16:58787146-58787168 CAATAGAGCGAGACTCTGTCGGG - Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139709794 16:68767212-68767234 CAACAGAGCGAGACTGTCTCAGG - Intronic
1139779770 16:69340740-69340762 CGACAGAGTGAAACTGTGTCAGG - Intronic
1139849947 16:69945103-69945125 TGACAGAGTGAGACCCTGTCTGG + Intergenic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1139878934 16:70168011-70168033 TGACAGAGTGAGACCCTGTCTGG + Intergenic
1140051377 16:71484420-71484442 CACCAGAGGGAGACCGGGACCGG + Intronic
1140256657 16:73342876-73342898 CAACACAGTGACACTGTGTGGGG + Intergenic
1140373584 16:74427482-74427504 TGACAGAGTGAGACCCTGTCTGG - Intergenic
1140460466 16:75135586-75135608 CAACAGAGTGAGACCCTGTCTGG + Intergenic
1140692577 16:77498711-77498733 TAACAGAGCGAGACCCTGTCTGG + Intergenic
1141301987 16:82825559-82825581 CAACAGAGGGAGACTCTGTTTGG - Intronic
1141485345 16:84335082-84335104 CAACAGAGTGAGACCCTGTCTGG + Intergenic
1142238253 16:88932947-88932969 CGACAGAGTGAGATTGTGTCTGG + Intronic
1142570539 17:870733-870755 CAACAGAGTGAGACTCTGTCTGG + Intronic
1142606046 17:1081595-1081617 TGACAGAGCGAGACCCTGTCTGG - Intronic
1142750468 17:1984381-1984403 TGACAGAGCGAGACCCTGTCTGG - Intronic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1143092740 17:4458702-4458724 CAACACAGGGAGACCCTGTCTGG - Intronic
1143133390 17:4695300-4695322 CAACAGAGTGAGACTCCGTCTGG + Intronic
1143361679 17:6376271-6376293 CAACAGAGTGAGACTCTGTCTGG + Intergenic
1143774714 17:9190830-9190852 CAACAGAGCAGGACTGTGTCTGG + Intronic
1144943530 17:18958088-18958110 CAACAGAGTGAAATCCTGTCTGG - Intronic
1145819114 17:27817741-27817763 CCACAGAGTGTGACAGTGTTTGG + Intronic
1145930596 17:28682599-28682621 CAACAGAGCGAGACCGTCTCAGG + Intronic
1146068082 17:29653604-29653626 CAACAGAGTGAGACTCTGTCTGG - Intronic
1146206701 17:30911085-30911107 CAAAAAAGTGAGACTGTCTCCGG + Intronic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146245837 17:31282038-31282060 CAATGGAGAGAGACCCTGTCTGG + Intronic
1146392511 17:32435760-32435782 CAACAGAGCGAGACTCTGTCTGG + Intergenic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1146862680 17:36318154-36318176 CAACAGAATGAGACCCTGTCTGG + Intronic
1146973453 17:37091597-37091619 CAACAGGAGGAGACCCTGTCTGG - Intronic
1147005658 17:37401577-37401599 CAACAGAGTGAGACCTCGTCTGG - Intronic
1147021045 17:37533379-37533401 TGACAGAGTGAGACTCTGTCTGG + Intronic
1147093008 17:38122250-38122272 CAACAGAATGAGACCCTGTCTGG + Intergenic
1147104200 17:38198238-38198260 CAACAGAATGAGACCCTGTCTGG - Intergenic
1147201361 17:38804023-38804045 CAACAGAGTGAGACCTTGTAGGG + Intronic
1147203046 17:38816702-38816724 CAACAGAGTGAAACTCTGTCTGG - Intronic
1147280109 17:39352659-39352681 CAACAGAGTGAAGCTCTGTCTGG + Intronic
1147288931 17:39425780-39425802 CGACAGAGTGAGACTCTGTCTGG + Intronic
1147340001 17:39747605-39747627 TGACAGAGTGAGACCCTGTCTGG + Intergenic
1147621033 17:41866834-41866856 CGACAGAGTGATACCCTGTCTGG + Intergenic
1147658819 17:42106137-42106159 TAACAGAGTGAGACTCTGTCTGG + Intronic
1147673125 17:42188408-42188430 CAACACAGCGAGACCATCTCGGG - Intergenic
1147742652 17:42677603-42677625 CAAGACAGCGAGACCCTGTCTGG - Intergenic
1147781831 17:42948658-42948680 CAACAGAGTGAGACTATATCTGG + Intergenic
1147833382 17:43312897-43312919 CAATAGAGTGAGACTGTGTTGGG + Intergenic
1148005853 17:44428778-44428800 TGACAGAGTGAGATCCTGTCTGG + Intronic
1148091630 17:45025769-45025791 CGACAGAGTGAGACTGTCTCAGG - Intronic
1148425293 17:47590175-47590197 CAACAGAATGAGACCCTGTCTGG + Intronic
1148906537 17:50915872-50915894 CAACAGGGTGAAACCTTGTGGGG - Intergenic
1148982590 17:51591589-51591611 CAACAAAGTGAGACCAAGTCTGG + Intergenic
1149748691 17:59124410-59124432 CAACAGAGTGAGACTCTGTCTGG + Intronic
1149878436 17:60262966-60262988 CAACAGAATGAGAACTTGTCTGG - Intronic
1149926258 17:60704936-60704958 CAAGATAGAGACACCGTGTCTGG - Intronic
1149968836 17:61195377-61195399 CAACAGAATGAGACCTTGTCTGG - Intronic
1150767286 17:68012218-68012240 CAACAGAGCAAGACCGTGTCTGG + Intergenic
1150772853 17:68056252-68056274 TGACAGAGTGAGACCTTGTCTGG - Intergenic
1150912263 17:69400514-69400536 CACCAGAGTGAGACTGTCTCGGG + Intergenic
1151044946 17:70908919-70908941 CAATAGAGTGAGACCCTGGGAGG - Intergenic
1151538899 17:74754420-74754442 CAACAGAGCAAGACTGTCTCAGG - Intronic
1151576584 17:74955479-74955501 CGACAGAGTGAGACGCCGTCGGG + Intronic
1151735892 17:75940260-75940282 CAACAGAGCGAGACCCTGTCTGG - Intronic
1151861834 17:76770049-76770071 CGACAGAGCGAGACTCTGTCTGG - Intronic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152106795 17:78334897-78334919 CAGCAGAGTGAGACGCTGTCTGG - Intergenic
1152127301 17:78454927-78454949 TGACAGAGTGAGACTCTGTCAGG - Intronic
1152398232 17:80048238-80048260 CAACAGAGCAAGACTCTGTCTGG + Intronic
1152439339 17:80296037-80296059 CCACAGAGTGAGACGCCGTCTGG - Intronic
1153009305 18:523373-523395 CCACAGAGTGAGACTCTGTCTGG + Intergenic
1153187097 18:2498185-2498207 CTCCAGAGTGAGACTCTGTCTGG - Intergenic
1153199757 18:2636005-2636027 CAACAGAGGGACTCCGTCTCGGG - Intergenic
1154214282 18:12404321-12404343 CAACAGAACAAGACCTTGTCTGG + Intergenic
1154946841 18:21170229-21170251 CAACAGTGCGAGACTCTGTCTGG + Intergenic
1154960613 18:21304997-21305019 CAACAGAGCGACACTCTGTCTGG - Intronic
1155035808 18:22023943-22023965 CAACAGAGCGACACCCTGCCAGG + Intergenic
1155059875 18:22219135-22219157 TGACAAAGTGAGACCGTCTCAGG - Intergenic
1155266899 18:24103080-24103102 CAACAGAGTGAGACCGTGTCTGG + Intronic
1155501613 18:26492220-26492242 CAATAGAGTGAGACCCTATCTGG + Intronic
1155955310 18:31951902-31951924 CGACAGAGTGAGACCCCGTCTGG + Intronic
1156082446 18:33354628-33354650 CGACAGAGTGAGACTCTGTCTGG - Intronic
1156968339 18:43124043-43124065 TAACAGAATGAGACCCTGTCTGG - Intergenic
1157997713 18:52578958-52578980 CAACAGAGTGAGACTCCGTCTGG + Intronic
1158575702 18:58635769-58635791 CAACAAAGTGAGACTTTGTCTGG + Intergenic
1158954950 18:62528577-62528599 CGACAGAGTGAGACTGTCTCGGG + Intronic
1159052305 18:63432494-63432516 CAACAGAGTGAGACCCTGTCTGG + Intergenic
1160779221 19:870539-870561 CAACAGAGTGAGACCCTGTCGGG + Intronic
1161188931 19:2942392-2942414 CAACAGAGCTAGACCCTGTCTGG - Intronic
1161616754 19:5275088-5275110 CGACAGAGTGAGACACTGTCTGG - Intronic
1161682937 19:5689209-5689231 CGACAGAGCAAGACCCTGTCTGG + Intronic
1161758646 19:6153826-6153848 CAACAGAGTGAGACCCTGTCTGG + Intronic
1162094932 19:8304715-8304737 CAACAGAGTAAGACTGTCTCAGG - Intronic
1162214612 19:9123013-9123035 CAACAGAGTGAGACTTTGTCTGG - Intergenic
1162280825 19:9696567-9696589 CAACAGAGTGAGACCCTGTCTGG - Intronic
1162313669 19:9923535-9923557 CAACAAAGTGAGACTGTCTCAGG + Intronic
1162522171 19:11187900-11187922 CAACATAGTGAGACCTCATCTGG + Intronic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1162759848 19:12882172-12882194 CAACAGAGCGAGATATTGTCCGG - Intergenic
1163000215 19:14362475-14362497 CAACAAAGTGAGACCGGGGAAGG + Intergenic
1163261340 19:16192073-16192095 CAAGAGAGTGAAACTCTGTCTGG - Intergenic
1163719263 19:18890759-18890781 CAACAGAGTAAGACCGCGTCTGG + Intronic
1163719417 19:18891595-18891617 CAACAGAGCGAGACCCTGCCTGG - Intronic
1164027782 19:21368754-21368776 CAACAGAGTAAGAATTTGTCTGG - Intronic
1164196820 19:22974877-22974899 CAACAGAGGGAGACTGTCTAGGG - Intergenic
1164921645 19:32092915-32092937 TGACAGAGTGAGACCCTGTCTGG + Intergenic
1164979910 19:32606170-32606192 CGACAGAGCGAGACTCTGTCTGG - Intronic
1165131031 19:33632157-33632179 TGACAGAGGGAGACCCTGTCTGG - Intronic
1165293132 19:34905156-34905178 CAACCGAGTGAGCTCGAGTCCGG + Intergenic
1165323274 19:35099369-35099391 CAACAGAGCAAGACCCTGTCTGG + Intergenic
1165383682 19:35497973-35497995 CAACAGAGGGAGACCCTGTCTGG - Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166189799 19:41168766-41168788 CAACAGAGCAAGACCCTTTCTGG - Intergenic
1166547330 19:43640986-43641008 CAACAGAGCGAGACTCCGTCTGG - Intergenic
1166664066 19:44666648-44666670 CGACAGAGTGAGAATCTGTCAGG + Intronic
1166698647 19:44868890-44868912 CGACAGAGTGAGACTCTGTCTGG + Intronic
1166900190 19:46055275-46055297 CAACACAGTGAGACCCTATCTGG - Intronic
1166946328 19:46399152-46399174 CGACAGAGTGAGACTCTGTCTGG - Intergenic
1167067293 19:47196063-47196085 CAACAGAGCGAGACTCCGTCTGG - Intronic
1167127286 19:47558762-47558784 CAACAGAGTGAAACTGTCTCAGG - Intergenic
1167421461 19:49406394-49406416 CGACAGAGCGAGACTGTCTCAGG - Intronic
1167765005 19:51476253-51476275 GGACAGAGTGAGACTCTGTCTGG + Intergenic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1167996007 19:53402747-53402769 CAACACAGCAAGACCCTGTCTGG - Intronic
1168001493 19:53449875-53449897 CAACACAGCAAGACCCTGTCTGG - Intronic
1168053601 19:53848289-53848311 TGACAGAGTGAGACTGTCTCCGG - Intergenic
1168596305 19:57680546-57680568 CAACAGAGTGAGACTCCGTCTGG + Intergenic
1168672035 19:58247932-58247954 TGACAGAGTGAGACTCTGTCTGG - Intronic
1168708538 19:58483628-58483650 CAACAGGATGAGACCCTGTCTGG + Intronic
925340061 2:3130017-3130039 TGACAGAGTGAAACCATGTCTGG + Intergenic
925371031 2:3345603-3345625 CAATAGAGCGAGACTCTGTCTGG + Intronic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
926689929 2:15726070-15726092 CAACAGAGACAGACAGTGTGGGG - Intronic
927557484 2:24046092-24046114 TGACAGAGTGAGACCCTGTTGGG + Intronic
927632439 2:24786227-24786249 CAACAGAGTGAGACTTTGTCTGG - Intergenic
927782508 2:25951143-25951165 CAACAGAGTGAGGCCTTGCCCGG - Intronic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928016203 2:27660248-27660270 TGACTGAGTGAGACCCTGTCTGG - Intronic
928141239 2:28731222-28731244 CGACAGAGTAAGACCCTGCCAGG - Intergenic
928159591 2:28909851-28909873 CAACACAGTGAGACCCTGTTTGG + Intronic
928344695 2:30480732-30480754 CAATAGAGTGAGACTGTTTCTGG + Intronic
928497571 2:31849578-31849600 CAACACAGGGAGACCGTCTTGGG + Intergenic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
928667696 2:33567186-33567208 CAACAGAGCGACACACTGTCTGG + Intergenic
928998889 2:37325501-37325523 AAACAAAGTATGACCGTGTCGGG + Intergenic
929184714 2:39081498-39081520 CAACAGAGTGAGACTGTCCTCGG + Intronic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
930059986 2:47280288-47280310 TGACAGAGCGAGACCCTGTCTGG - Intergenic
930110462 2:47674691-47674713 TGACAGAGTGAGACCCTGTCTGG + Intergenic
930525972 2:52530108-52530130 CAACAGAATGAGACCCTGTCTGG - Intergenic
930695631 2:54408871-54408893 AGACAGAGTGAGATCCTGTCTGG - Intergenic
931349372 2:61473736-61473758 TGACAGAGTGAGACCCTCTCTGG + Intergenic
931670795 2:64644926-64644948 CAACAGGGAGAGACCGTCTCTGG + Intronic
931740048 2:65233920-65233942 CAACAGAGTGAGACCCTGTCAGG - Intronic
932382639 2:71299198-71299220 CAACAGAGCGAGACCCTGTCTGG + Intronic
932559278 2:72852909-72852931 TGACAGAGTGAGACCCTGTCTGG + Intergenic
932724729 2:74169646-74169668 CAACAGAGTGAGACCCAGTCGGG - Intronic
933592488 2:84248305-84248327 CAACAGAGTGAGACTCTGTCAGG - Intergenic
933914098 2:86971052-86971074 CGACAGAGTAAGACTGTCTCAGG - Intronic
933945548 2:87283366-87283388 TGACAGAGTGAGACTCTGTCTGG - Intergenic
934008895 2:87798846-87798868 CGACAGAGTAAGACTGTCTCAGG + Intronic
934706048 2:96481936-96481958 CAACAGAGCGAGACTCTGTCTGG + Intergenic
935213208 2:100955861-100955883 CAAAAGAGAGAGAGGGTGTCAGG - Intronic
935243522 2:101198483-101198505 CGACAGAGCGAGAACTTGTCTGG - Intronic
935265998 2:101394808-101394830 CCACAGAGCGAGGCCCTGTCCGG - Intergenic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
935772541 2:106439844-106439866 CGACAGAGTAAGACTGTCTCAGG + Intronic
935907531 2:107856071-107856093 CGACAGAGTAAGACTGTCTCAGG - Intronic
936011067 2:108925635-108925657 CAACAGAAGGAGACTGTTTCAGG - Intronic
936129322 2:109821213-109821235 CGACAGAGTAAGACTGTCTCAGG - Intronic
936215375 2:110550272-110550294 CGACAGAGTAAGACTGTCTCAGG + Intronic
936317145 2:111433222-111433244 CAGCAGAGTGTGACAGTGCCAGG + Intergenic
936334664 2:111578220-111578242 TGACAGAGTGAGACTCTGTCTGG + Intergenic
936424512 2:112404845-112404867 CGACAGAGTAAGACTGTCTCAGG + Intronic
936696919 2:114961766-114961788 CAACATGGTGAAACCCTGTCTGG + Intronic
936939482 2:117869785-117869807 CGAAAGAGTGAGACTCTGTCTGG - Intergenic
937374510 2:121326518-121326540 TGACAAAGTGAGACCCTGTCTGG - Intergenic
937802082 2:126092000-126092022 CAACATAGGGAGACCTGGTCTGG - Intergenic
938275621 2:130018971-130018993 CAACAGAGTGAAACTCTTTCTGG - Intergenic
938399125 2:130974250-130974272 CAACAGAGTGAGATCTTGTCTGG + Intronic
938413858 2:131088224-131088246 CAACAGAGCAAGACTCTGTCTGG + Intronic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
938612912 2:132967896-132967918 CAACAGAGTGAGGCTGAGTGAGG + Intronic
938894124 2:135733938-135733960 CAACAGAGCGAGACGCCGTCTGG + Intergenic
938957794 2:136314819-136314841 CAACAGAGTGAGACGCCTTCTGG - Intergenic
939531294 2:143364984-143365006 CAACAGAGCGAGACTCTGTGTGG + Intronic
939805279 2:146768431-146768453 CAACTCAGTAAGACCCTGTCAGG - Intergenic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
941952529 2:171171332-171171354 TGACACAGTGAGACCCTGTCTGG + Intronic
942465343 2:176202226-176202248 CGACAGAGTGAGACCCCATCTGG - Intergenic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
944565386 2:200985089-200985111 CAACAGAGTGAGACCATCTGGGG + Intronic
944703497 2:202265925-202265947 CAACATGGTGAGGCCGGGTCAGG - Exonic
944936009 2:204568933-204568955 TGACAGAGTGAGACTGTCTCAGG + Intronic
945094765 2:206208657-206208679 TGACAGAGTGAGACCCTGCCTGG - Intronic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945280800 2:208033664-208033686 CAACAGAGTGAGACTCCATCTGG + Intergenic
945388094 2:209228433-209228455 TGACAGAGTGAGACTCTGTCTGG - Intergenic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
946231426 2:218293603-218293625 TGACAGAGCGAGACCCTGTCTGG - Intronic
947078066 2:226365845-226365867 CGACAGAGTGAGACTCTATCTGG - Intergenic
947173623 2:227338022-227338044 CAACACAATGAGACCCTATCTGG + Intronic
947297178 2:228643894-228643916 CGACAGAGTGAGACTCTGTCTGG + Intergenic
947442542 2:230135919-230135941 CAACAGAGTGAGATCCTGTGTGG - Intergenic
947487159 2:230561826-230561848 TGACAGAGTGAGACTCTGTCTGG + Intergenic
947505174 2:230703285-230703307 CAACAGAGTGAGACTCTGTCTGG - Intergenic
947562918 2:231173504-231173526 CAACAGGGCAAGACCCTGTCTGG + Intergenic
947703213 2:232252913-232252935 CAACATAATGAGACCTTGTGTGG + Intronic
947723772 2:232384391-232384413 CAACAGAGCAAGACCCTGTCTGG + Intergenic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169169617 20:3454270-3454292 CAACAGAGAGAGACCCTGTCTGG - Intergenic
1169419898 20:5451471-5451493 CAACAGAGTGAGACTCTGTTGGG + Intergenic
1169454682 20:5741838-5741860 CAACAGAGTGAGACCGTATCCGG + Intergenic
1171546508 20:26006117-26006139 TGACAGAGTGAGACCCTGTCTGG - Intergenic
1172289826 20:33768140-33768162 CGACAGAGTGAGACTGCCTCGGG - Intronic
1172411570 20:34727741-34727763 CGACAGAGTGACACTCTGTCTGG - Intronic
1172551661 20:35805216-35805238 CAACAGAATGAGACCTTGTCTGG - Intronic
1172579782 20:36037616-36037638 AGACAGAGTGAGACCCTATCTGG - Intergenic
1173008381 20:39158360-39158382 CAACACAGTGAGACCCTGTCTGG - Intergenic
1173681036 20:44882035-44882057 CAACAGAGTGAGACTCTCTCTGG + Intergenic
1173945247 20:46945094-46945116 TGACAGAGTGAGACCTTGTCTGG + Intronic
1174014334 20:47475613-47475635 CAACAGAGTGAGACTCTGTTGGG + Intergenic
1174042968 20:47713019-47713041 TAACAGAGCCAGACCCTGTCTGG + Intronic
1174485745 20:50860114-50860136 CGACAGAGTGAGATCCTGCCTGG + Intronic
1174585767 20:51606876-51606898 AAACAGAGTGAGACCCTGGGTGG - Intronic
1174602119 20:51733391-51733413 CAACAGAATTAGACTCTGTCTGG - Intronic
1174610376 20:51793439-51793461 TGACAGAGTGAGACCCTGTCTGG + Intronic
1174810370 20:53640368-53640390 CGACAGAGTGAGACTTTGTTTGG - Intergenic
1174825178 20:53762253-53762275 CAACAGAGTGAGACCCTGTCAGG - Intergenic
1175235331 20:57506321-57506343 CAACAGAGCGAGACTGTCTCAGG - Intronic
1175413611 20:58787211-58787233 GAACAGAGAAAGACCGTCTCTGG - Intergenic
1175709630 20:61208982-61209004 CGACAGAGTGAGACTCTGTCTGG - Intergenic
1175848833 20:62075897-62075919 CAACAGAGTGAAACTTTGTCTGG + Intergenic
1175884927 20:62284394-62284416 CAACAGAGGGAGACCCTGCCTGG - Intronic
1175970003 20:62680922-62680944 TGACAGAGTGAGACCCTGTCTGG - Intronic
1176141091 20:63545417-63545439 AAGCAGAGTGAGCCGGTGTCAGG + Intronic
1176969391 21:15248368-15248390 CAACAGAGTGACATCCTGTCTGG - Intergenic
1177456433 21:21344927-21344949 AAATAGAGTGAGACTGTGTTTGG + Intronic
1177846596 21:26296048-26296070 CAACAGAATGAGACTCTGTCTGG - Intergenic
1178608703 21:34061073-34061095 CAAAAGAGTGAAACTCTGTCTGG + Intergenic
1178614168 21:34116025-34116047 TAACAGAGTGAAACCCTGTCGGG - Intronic
1178628303 21:34236858-34236880 CAACAAAATGAGACTCTGTCTGG + Intergenic
1178839222 21:36125351-36125373 CGACAGAGTGAGACTGTCTCAGG + Intergenic
1179138775 21:38703673-38703695 CTACAGGGTGAGACTGTCTCAGG + Intergenic
1179208355 21:39304592-39304614 CAACAAAGTGAGAACTTGTCTGG + Intronic
1179457543 21:41509297-41509319 CAACAGAGTGAGACCCCTTCTGG - Intronic
1179530729 21:42017499-42017521 TGACAGAGTAAGACCCTGTCTGG - Intergenic
1179663836 21:42896001-42896023 CAACAGAGTGAGACTGTCTCAGG - Intronic
1179792790 21:43765036-43765058 TGACAGAGTGAGAACCTGTCTGG - Intergenic
1180166175 21:46031104-46031126 CCACAGAGTGAGACTCTGTCGGG - Intergenic
1180608444 22:17079475-17079497 TGACAGAGTGAGACTCTGTCTGG + Intergenic
1180847041 22:18989198-18989220 CAACAGAGCAAGAACCTGTCTGG + Intergenic
1180915704 22:19484956-19484978 AAACAGAGAGAGACCCCGTCTGG - Intronic
1180968189 22:19801335-19801357 CACCAGAGTGAGACCTGGACAGG + Intronic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1181754762 22:25016038-25016060 CAACAGAGCGAGACTCCGTCTGG - Intronic
1181776672 22:25164926-25164948 CAACAGAGTGAGACTGTCTCGGG + Intronic
1182221646 22:28763466-28763488 CAACAGAGCAAGACCCTGCCTGG + Intergenic
1182231779 22:28842947-28842969 CAACAGAGCAAGACTCTGTCTGG + Intergenic
1182479963 22:30601790-30601812 AAACAGAGCGAGACTGTGTCTGG - Intronic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1182655889 22:31889567-31889589 CAACAGAGCGAGACTCTGTCTGG - Intronic
1182979636 22:34656970-34656992 CAACAGAGTGAGACTCCTTCTGG - Intergenic
1183444039 22:37841060-37841082 CAACAAAGTGAGACTGTCTCAGG + Intronic
1183647720 22:39136068-39136090 CGACAGAGCGAGACTCTGTCTGG + Intronic
1183793690 22:40097323-40097345 AAACAGAGAAAGACCCTGTCTGG - Intronic
1183845922 22:40539927-40539949 CAACAGAGTGAGACCCTGTCTGG - Intronic
1183879887 22:40818684-40818706 CAACAGAGCAAGACCCTGTCCGG + Intronic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184513904 22:44948669-44948691 TGACAGAGTGAGACTCTGTCTGG + Intronic
949152881 3:791680-791702 TGACAGAGTGAGACTCTGTCTGG + Intergenic
949836851 3:8279263-8279285 GAAAAGAGGGAGACCGTGTAAGG + Intergenic
950001387 3:9659208-9659230 CAACAGAGGAAGACCTTGTTGGG + Intronic
950211015 3:11123357-11123379 CAACAGAGCAAGACCCTGTCTGG + Intergenic
950308718 3:11937180-11937202 CAACAGAATGAGACCCTGTCTGG - Intergenic
950383015 3:12633461-12633483 CAACAGAGGGAGACCCTGTCTGG + Intronic
952061521 3:29516601-29516623 CAACACAGTGAGACCTTCTTAGG - Intronic
952171120 3:30808010-30808032 CAACAGAGAGAGACCCCTTCGGG + Intronic
952368203 3:32693559-32693581 TGACAGAGTGAGACCCTGTCTGG - Intronic
952768727 3:36977725-36977747 TGACAGAGGGAGACCCTGTCAGG + Intergenic
952792951 3:37214760-37214782 TAACAGAGTGAGACCCTGTCTGG + Intergenic
953306680 3:41837581-41837603 TGACAGAGTGAGACTCTGTCTGG - Intronic
953365800 3:42343875-42343897 CAACAGAGCGAGACTCTGTCTGG - Intergenic
953752694 3:45621248-45621270 CAACAGAGCAAGACCCTGTAAGG - Intronic
953889067 3:46736994-46737016 TGACAGAATGAGACCCTGTCTGG - Intronic
954058602 3:48049916-48049938 CAACAGAGTGAGACTTCGTCTGG + Intronic
954349357 3:50030007-50030029 CAACAGAGTGAGACTTTGGGAGG + Intronic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
954526007 3:51271829-51271851 CAACAGAGCGAGACTGTCTCAGG + Intronic
954678712 3:52329803-52329825 CAACAGAGTGAGACTCCATCTGG + Intronic
955328406 3:58027170-58027192 TGACAGAGGGAGACCCTGTCTGG - Intronic
955361060 3:58275347-58275369 TGACAGAGTGAGACTCTGTCTGG - Intronic
955368388 3:58331176-58331198 TAACAGAGCAAGACCGTCTCCGG - Intergenic
955391835 3:58527514-58527536 TGACAGAGTGAGACTGTCTCAGG + Intronic
955793302 3:62610067-62610089 TGACAGAGTGAGACCCTTTCTGG + Intronic
956101736 3:65775427-65775449 CAACAGAGTGAGACCTTCTCTGG + Intronic
956796474 3:72722831-72722853 CCCCAGAGTGAGATCCTGTCTGG + Intergenic
957305343 3:78450831-78450853 CAAGAGAGGGAGAAGGTGTCAGG + Intergenic
957924256 3:86788494-86788516 AGACAGAGTGAGAACCTGTCTGG - Intergenic
958264655 3:91423952-91423974 CAACATAGCAAGACCTTGTCTGG - Intergenic
958608675 3:96395080-96395102 TGACAGAGTGAGACTCTGTCTGG - Intergenic
959332829 3:105027419-105027441 CAACAGAGTGAGACTCTATCTGG - Intergenic
959374005 3:105565008-105565030 CAACAGAGCAAGACTCTGTCTGG + Intronic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
959502942 3:107127360-107127382 CAACAGAGTGAGGTTGTTTCTGG - Intergenic
960605380 3:119499111-119499133 CGACAGAGCAAGACCCTGTCTGG - Intronic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
960895500 3:122500513-122500535 CAACAGAGAGAGAGAGTATCTGG - Intronic
961143274 3:124573519-124573541 TAATAGAGTGAGACCCTGTCTGG - Intronic
961186686 3:124921167-124921189 CAACAGAGTGAGACTCTGCCTGG - Intronic
961597596 3:128030980-128031002 TGACAGAGAGAGACCCTGTCTGG - Intergenic
961896121 3:130169085-130169107 TGACAGAGTGAGACCCTGTATGG + Intergenic
963810162 3:149768559-149768581 CAACAGAGCAAGACTCTGTCTGG - Intronic
963893712 3:150663472-150663494 CAACAGAGCAAGACCCTGTTAGG - Intronic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
964113216 3:153108321-153108343 CAACAGAGTGAGACTCCGTCTGG + Intergenic
964356506 3:155855886-155855908 CGACAGAGTGAGACTCCGTCTGG + Intergenic
964621623 3:158724843-158724865 TAACATAGTGAGACCCTGTCTGG - Intronic
964622320 3:158730443-158730465 CAACAGAGTGAGACCCTATGGGG - Intronic
964891903 3:161546738-161546760 CAATAGAGTGAGATCCTCTCTGG - Intergenic
964976952 3:162633571-162633593 TGACAGAGTGAAACCCTGTCTGG - Intergenic
965769043 3:172161627-172161649 CAACAGTGTCAGACATTGTCAGG - Intronic
965770175 3:172173798-172173820 CAACAGAGCAAGACCCTGTCTGG + Intronic
966528874 3:180951201-180951223 TGACAGAGTGAGACCCTGTCTGG + Intronic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
967058654 3:185851967-185851989 CGACAGAGAGAGACCCTGTGTGG + Intergenic
967798957 3:193632836-193632858 CAATAGAGCAAGACCCTGTCTGG + Intronic
968036346 3:195551333-195551355 CAATAGAGTGAGACTCAGTCTGG + Intergenic
968130163 3:196188557-196188579 CAACAGAGTGAGACTCCATCTGG - Intergenic
968181878 3:196601396-196601418 CCTCAGTGTGAGACTGTGTCTGG + Intergenic
968326213 3:197819104-197819126 CAACAGAGTGAGATTCCGTCTGG + Intronic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
969112016 4:4850150-4850172 CAACAGAGTGAGACCCTGTCTGG + Intergenic
969595270 4:8145201-8145223 CGACAGAGCGAGACTCTGTCTGG - Intronic
970081997 4:12298022-12298044 CAACAGAGTGAGACTGTCTCAGG - Intergenic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
971032522 4:22656172-22656194 TGACAGAGTGAGATCTTGTCCGG - Intergenic
971722236 4:30260228-30260250 CAGCAGAGAAAGACAGTGTCAGG + Intergenic
971849191 4:31961328-31961350 CCACAGAGTGAGACTCTGTCTGG - Intergenic
972090049 4:35270016-35270038 CAATAGAGTGAGACCTTGTCTGG - Intergenic
972425189 4:38926472-38926494 CAACAGAATGAGACTCTATCTGG - Intronic
972516177 4:39812684-39812706 CAACAGAGTGAGACCCCATATGG + Intergenic
972528578 4:39940197-39940219 TGACAGAGCGAGACCCTGTCTGG + Intronic
972531182 4:39962774-39962796 CAACAGAGCGAGACTCCGTCTGG + Intronic
972646606 4:40973869-40973891 CGACAGAGTGAGACTCTGTCTGG - Intronic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
973111407 4:46402594-46402616 AAAAAGAGTGAGACACTGTCAGG - Intronic
973134612 4:46690791-46690813 TGACAGAGTGAGACCCTTTCTGG - Intergenic
974148416 4:57974513-57974535 CGACAGAGCGAGACTCTGTCTGG - Intergenic
974393111 4:61299272-61299294 CATCATAGTGAGGCTGTGTCAGG + Intronic
975068513 4:70100924-70100946 CGACAGAGCGAGACTCTGTCTGG + Intergenic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
976155149 4:82136060-82136082 TGACAGAGTGAGACTCTGTCTGG + Intergenic
976302508 4:83528637-83528659 TGACAAAGTGAGACCCTGTCTGG + Intergenic
976595313 4:86890144-86890166 TGACAGTGTGAGACCCTGTCAGG + Intronic
976608170 4:87002121-87002143 CAACAGAGCAAGACCGTCTCTGG - Intronic
976664666 4:87577698-87577720 CAACAGAGCAAGACTCTGTCTGG - Intergenic
977697812 4:99986153-99986175 CAACAGAGTGAGACTCTGTCTGG + Intergenic
977938709 4:102834727-102834749 TGACAGAGTGAGACCCTGTCTGG + Intronic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
978578731 4:110211820-110211842 CATCAGAGAGAGACCATGACTGG + Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
979801135 4:124910460-124910482 TGACAGAGTGAGACCTTGTCTGG - Intergenic
979854973 4:125621203-125621225 CCACAGAGTAAGACTGTATCTGG + Intergenic
980945200 4:139312824-139312846 TGACAGAATGAGACCTTGTCTGG + Intronic
981194775 4:141906147-141906169 TGACAGAGTGAGACTGTCTCAGG - Intergenic
981759516 4:148178309-148178331 CAACAGAGTGAGACTCTGTCTGG + Intronic
981806762 4:148724994-148725016 CAACATAGGGAGACCCCGTCTGG - Intergenic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
982178301 4:152727260-152727282 TAACAGAGTGAGACACTGTTTGG - Intronic
982328662 4:154157199-154157221 CAACAGAGTGAGACCATCTCCGG - Intergenic
982453410 4:155578777-155578799 CTACAGAGTGAGACTCTGTCTGG + Intergenic
983613911 4:169679857-169679879 CAACAGAGGGAGACCGTGGAAGG + Intronic
983780667 4:171666402-171666424 CAACAGAGTGACACCCTGTCTGG + Intergenic
984482821 4:180327448-180327470 CGACAGAGTGAGACCCCATCTGG + Intergenic
984712168 4:182895094-182895116 CAACAGAACGAGACCCAGTCTGG - Intronic
984718912 4:182952281-182952303 CAATAGAGGGAGAGCGTGGCAGG - Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
984927918 4:184822718-184822740 CGACAGAGTGAGACCTTATCTGG + Intronic
985102223 4:186469867-186469889 CAACACAGTGAGAGCTCGTCTGG + Intronic
985226608 4:187768140-187768162 CAGCAGAGTGAGACTTCGTCTGG - Intergenic
986231194 5:5866187-5866209 CAACAGAGCAAGACCCTGTTTGG - Intergenic
986328896 5:6703024-6703046 CAACAGAATAAGGCCCTGTCTGG - Intergenic
986362935 5:6999214-6999236 CAACATAGTAGGACTGTGTCCGG - Intergenic
986874668 5:12093730-12093752 CAACAGAGTGAAACTCTGTTGGG + Intergenic
987328634 5:16835155-16835177 CGACAGAGTGAGACTGTCTCGGG + Intronic
987376507 5:17240236-17240258 CAACAGAGTGAGGCTCTGGCCGG + Intronic
987675720 5:21070418-21070440 CAAAAGGGAGAGACTGTGTCAGG - Intergenic
987710674 5:21498149-21498171 CAACAGAACAAGACCCTGTCAGG - Intergenic
988502761 5:31797431-31797453 CAACAGAGTGAAACCCTGTCTGG + Intronic
989017502 5:36956208-36956230 CAACAGAGTAAGACTCCGTCTGG + Intronic
989042318 5:37241644-37241666 TGACAGAGTGAGACCCTGTCTGG - Intronic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
990225011 5:53640566-53640588 CAAGAGAGAGAGAATGTGTCAGG + Intronic
990556828 5:56944709-56944731 TGACAGACTGAGACCCTGTCTGG - Intronic
991058623 5:62346718-62346740 TAACAGAGCGAGACTGTCTCAGG + Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
991458949 5:66836149-66836171 TGACAAAGTGAGACCCTGTCTGG + Intronic
991676307 5:69092848-69092870 CAACAGAGCAAGACCGTCTCTGG - Intergenic
991761012 5:69917212-69917234 CAACAGAACAAGACCCTGTCAGG - Intergenic
991773445 5:70061224-70061246 TAACAAATTGAGACCTTGTCTGG - Intronic
991786318 5:70200889-70200911 CAACAGAACAAGACCCTGTCAGG + Intergenic
991840241 5:70792263-70792285 CAACAGAACAAGACCCTGTCAGG - Intergenic
991852739 5:70936648-70936670 TAACAAATTGAGACCTTGTCTGG - Intronic
991878762 5:71201274-71201296 CAACAGAACAAGACCCTGTCAGG + Intergenic
992199380 5:74368766-74368788 TGACAGAGTGAGACTCTGTCTGG - Intergenic
992420104 5:76595272-76595294 CAATAGAATAAGACCCTGTCCGG - Intronic
992560080 5:77942817-77942839 CAATAGAGCAAGACCCTGTCTGG + Intergenic
992739112 5:79755304-79755326 CGACAGAGTGAGACTCTGTGTGG - Intronic
992971262 5:82060830-82060852 TGACAGAGTGAGACCTTGTCTGG + Intronic
993330623 5:86595343-86595365 AAACAGAGCAAGACCCTGTCTGG + Intergenic
994061549 5:95484364-95484386 CAACAGAATGAGATCCTGTCTGG - Intronic
994196822 5:96931174-96931196 CAACAGAGTGAGATCCTGTCTGG - Intronic
995864710 5:116678770-116678792 CAACAGAGAGAGACTCTGTCTGG - Intergenic
996164575 5:120209385-120209407 CAACAGAGTGAGACTGTGCCTGG + Intergenic
996378255 5:122838137-122838159 TGACAAAGTGAGACCCTGTCTGG + Intergenic
997483025 5:134203739-134203761 CGACAGAGTGAGATCCTATCTGG - Intronic
997935062 5:138103300-138103322 CAACTGAGTTTGACCGTGACTGG - Intergenic
998049134 5:139016864-139016886 TGACAGAGTGAGGCCCTGTCAGG - Intronic
998076792 5:139243149-139243171 CAAAAGAGTGAGACCTTGGCTGG + Intronic
998659166 5:144216822-144216844 CCACAGAGGGAGACTCTGTCTGG + Intronic
998709367 5:144805108-144805130 TGACAGAGTGAGACTGTCTCAGG + Intergenic
998725338 5:145006521-145006543 CAACAGAGCGAGATGCTGTCTGG - Intergenic
1000059920 5:157645640-157645662 CAACAGAGTGAGACCCTGTCTGG + Intronic
1000294237 5:159899125-159899147 TGACAAAGTGAGACCCTGTCAGG + Intergenic
1000625156 5:163529918-163529940 CAACAGACCAAGACCCTGTCTGG + Intergenic
1001472820 5:172026951-172026973 TGACAGAGCGAGACCCTGTCAGG - Intergenic
1001709036 5:173763052-173763074 TGACAGAGCGAAACCGTGTCTGG + Intergenic
1001731756 5:173965335-173965357 CAACAAAGTGAGACCATCTTGGG + Intergenic
1002069231 5:176669206-176669228 CATCAGAGTGAGGCCCTGGCTGG + Intergenic
1002308991 5:178303018-178303040 CAACAGAGCTAGACTCTGTCAGG - Intronic
1002320487 5:178372590-178372612 CAATAGAGAGAGACTTTGTCTGG - Intronic
1002490333 5:179571482-179571504 CAACAGAGCCAGACTCTGTCTGG + Intronic
1003395505 6:5749264-5749286 CAACAGAGTGAGGAAGTGGCTGG + Intronic
1003577051 6:7306895-7306917 CGACAGAGCGAGACTCTGTCTGG + Intronic
1003595710 6:7472442-7472464 CAACAGAGCAAGACTCTGTCTGG - Intergenic
1003878865 6:10462386-10462408 CAGCAGAGCAAGACCATGTCTGG + Intergenic
1003885988 6:10521917-10521939 TGACAGAGTGAGACTATGTCTGG - Intronic
1004072254 6:12311293-12311315 CAACAGAGGGAGTCCTTGTAAGG + Intergenic
1004476078 6:15973510-15973532 CAACAAAGTGAGACTCTGTCTGG - Intergenic
1005082823 6:21973990-21974012 TGACAGAGTGAGACCCTGTCTGG + Intergenic
1005400685 6:25430447-25430469 CAACAGTGCGAGACCCTGTCTGG - Intronic
1005515103 6:26547254-26547276 AGACAGAGTGAGACTCTGTCTGG - Intergenic
1005570862 6:27144440-27144462 CAACAGAGTGAGACTCTGTCTGG + Intergenic
1005919321 6:30385182-30385204 CAACAGAGTGAGACTTCATCTGG + Intergenic
1006259912 6:32859030-32859052 TGACAGAGAGAGACCCTGTCTGG + Intronic
1006548425 6:34799468-34799490 TGACAGAGTGAGACCCTGTCTGG + Intronic
1006584099 6:35094418-35094440 CAAAAGAGTGAGACTTCGTCTGG + Intergenic
1006885621 6:37379931-37379953 CGACAGAGTGAGACACTGTCTGG - Intronic
1007471004 6:42090346-42090368 CAACAGAGTGAGACTTCATCTGG + Intergenic
1007542500 6:42660945-42660967 CAACGGAGCGAGACCCTGTGTGG + Intronic
1007611554 6:43152505-43152527 CGACAGAGTGAGACTCCGTCTGG + Intronic
1007792582 6:44320127-44320149 CAACAGAGCGAGACTCTGTCTGG + Intronic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1008990732 6:57598699-57598721 CAACATAGCAAGACCTTGTCTGG + Intronic
1009017772 6:57923438-57923460 CAACAGAACAAGACCCTGTCAGG + Intergenic
1009907217 6:69884874-69884896 CAACAGAGCGAGACTCAGTCTGG - Intronic
1010214933 6:73393275-73393297 TAACATAGTGAGACCCTGCCGGG - Intronic
1010245051 6:73654508-73654530 CAACAGAGCAAGACCCTGCCTGG - Intergenic
1010430367 6:75771020-75771042 CAACAAAGTGAGACCATCTCAGG - Intronic
1011075508 6:83434323-83434345 CAACAGCGTGAGACTCTGTTGGG - Intergenic
1011281295 6:85680504-85680526 TCACAAAGTGAGACCTTGTCTGG - Intergenic
1012261350 6:97091187-97091209 CAATAGAGCGAGACCCTGTCTGG + Intronic
1013019520 6:106198754-106198776 TGACAGAGCGAGACCCTGTCTGG + Intronic
1013052921 6:106554590-106554612 CAACAGAGCAAGACTGTCTCAGG + Intronic
1013209023 6:107970338-107970360 CCAGAGAGTGAGACCCTGTCTGG - Intergenic
1013266247 6:108502044-108502066 CAACAGAGTGAGACTCTGTCTGG - Intronic
1013377370 6:109530825-109530847 CAACAGATCGAGACCATATCTGG - Intronic
1013435319 6:110099243-110099265 GGGCAGAGTGAGACCCTGTCTGG - Intergenic
1013931124 6:115534392-115534414 CAACAGAGTGAGACCCCGTCTGG - Intergenic
1015116353 6:129654021-129654043 TGACAGAGCGAGACCCTGTCTGG + Intronic
1015338889 6:132074789-132074811 CAACAGAGCAAGACTCTGTCTGG - Intergenic
1015950417 6:138547398-138547420 CAACAGAGTGAGACCCTCTCAGG - Intronic
1016381874 6:143492386-143492408 TGACAGAGTGAGACCCTGTCTGG + Intergenic
1016827364 6:148400729-148400751 CGACAGAGTGAGACTTTGTCTGG + Intronic
1017096560 6:150810287-150810309 TGACAGAGTGAGACCCTGTCTGG - Intronic
1017290336 6:152728142-152728164 CAACAGAGTGAGCCTCTGTCTGG + Intergenic
1017566995 6:155697989-155698011 TGACAGAGTGAGACACTGTCTGG + Intergenic
1017936527 6:159010345-159010367 TGACAGAGTGAGACCCTGTCAGG - Intergenic
1017969952 6:159303742-159303764 CAACATTGTGAAACCATGTCAGG - Intergenic
1018086513 6:160305544-160305566 CAACTGAGCAAGACCCTGTCTGG + Intergenic
1018359959 6:163057433-163057455 TGACAGAGTGAGACTCTGTCTGG - Intronic
1018693601 6:166370809-166370831 CAACAGAGCAAGACCCTGTCTGG + Intronic
1019183615 6:170208302-170208324 CAAAGGAGTGAGCCCCTGTCTGG - Intergenic
1019424919 7:970152-970174 CAATAGAGCGAGACTGTTTCTGG - Intronic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1019822621 7:3256861-3256883 CAACAGAGTGAAGCCCTGTCTGG + Intergenic
1020052335 7:5090119-5090141 CAACAGAATGAGACCCTCTTTGG - Intergenic
1020095240 7:5364782-5364804 CAACAGAGGGAGGCTGTCTCAGG + Intronic
1020115124 7:5471925-5471947 CAACACAGTAAGACCCTGTGTGG + Intronic
1020213923 7:6174565-6174587 CAGCAGAGCGAGACTCTGTCTGG - Intronic
1020326823 7:6980717-6980739 TGTCAGAGTGAGACCCTGTCTGG + Intergenic
1020628348 7:10610560-10610582 CAACAGAGCGAGACTGCGTCTGG - Intergenic
1021443997 7:20713251-20713273 TAACAAAATGAGACCCTGTCTGG - Intronic
1021712900 7:23434056-23434078 AGACAGAGTGAGACTCTGTCTGG + Intronic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1022686930 7:32605926-32605948 TGTCAGAGTGAGACCTTGTCTGG - Intergenic
1023387592 7:39675711-39675733 CAACAGAGTGAGACCATGTCTGG + Intronic
1023476729 7:40587920-40587942 CGGCAGAGTGAGACTCTGTCTGG - Intronic
1023975983 7:45030454-45030476 AAACAGAGTGAGACCCTGTCTGG - Intronic
1024257188 7:47547918-47547940 CGACAGAGTGAGACTCCGTCAGG - Intronic
1024350834 7:48361074-48361096 CAACAGAGTGAGACCCTGTTTGG + Intronic
1025241354 7:57278827-57278849 CGACAGAGCGAGACTCTGTCTGG - Intergenic
1025951275 7:66147373-66147395 CCAAGGACTGAGACCGTGTCTGG - Intronic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026004024 7:66586734-66586756 CGACAGAGTGAGACTCAGTCTGG - Intergenic
1026090434 7:67295213-67295235 AGACAGAGTAAGACCCTGTCTGG - Intergenic
1026340643 7:69431178-69431200 TGACAGAGTGAGATCCTGTCTGG - Intergenic
1026349580 7:69503934-69503956 CAACATAGTGAAACAGTGCCTGG + Intergenic
1026460466 7:70610453-70610475 CAACAGAATGAGACTCTGTCAGG - Intronic
1026503051 7:70959298-70959320 TGACAGAGTGAGACACTGTCTGG - Intergenic
1026708666 7:72717279-72717301 CAACAGGGCAAGACCCTGTCTGG + Intronic
1026746000 7:73013646-73013668 AGACAGAGTAAGACCCTGTCTGG + Intergenic
1026749653 7:73041790-73041812 AGACAGAGTAAGACCCTGTCTGG + Intergenic
1026753301 7:73069900-73069922 AGACAGAGTAAGACCCTGTCTGG + Intergenic
1026756952 7:73097936-73097958 AGACAGAGTAAGACCCTGTCTGG + Intergenic
1026771976 7:73208003-73208025 CAACAGAGCAAGACTGTCTCAGG - Intergenic
1026835656 7:73637453-73637475 TGACAGAGTGAGACTCTGTCTGG + Intergenic
1026954097 7:74365964-74365986 CAACATAGCGAGACCCTGCCTGG - Intronic
1026956466 7:74379307-74379329 CAACAGAGGGAGACTCCGTCTGG + Intronic
1027012844 7:74761395-74761417 CAACAGAGCAAGACTGTCTCAGG - Intergenic
1027027498 7:74864360-74864382 TGATAGAGTGAGACCTTGTCTGG + Intergenic
1027032105 7:74898205-74898227 AGACAGAGTAAGACCCTGTCTGG + Intergenic
1027060254 7:75079735-75079757 TGATAGAGTGAGACCTTGTCTGG - Intergenic
1027075196 7:75184653-75184675 CAACAGAGCAAGACTGTCTCAGG + Intergenic
1027090454 7:75295550-75295572 AGACAGAGTAAGACCCTGTCTGG - Intergenic
1027094099 7:75323478-75323500 AGACAGAGTAAGACCCTGTCTGG - Intergenic
1027097742 7:75351445-75351467 AGACAGAGTAAGACCCTGTCTGG - Intergenic
1027198895 7:76050049-76050071 CAACAGAGTGGGACTCTGTCAGG - Intronic
1027222192 7:76221075-76221097 CAACAAAGTGAGACCTTGTCTGG - Intronic
1027271799 7:76525083-76525105 AGACAGAGTAAGACCCTGTCTGG + Intergenic
1027321605 7:77016224-77016246 AGACAGAGTAAGACCCTGTCTGG + Intergenic
1027325240 7:77044147-77044169 AGACAGAGTAAGACCCTGTCTGG + Intergenic
1027478409 7:78663224-78663246 CGAGAGAGTGAGACTGTGTCTGG - Intronic
1028038705 7:86019616-86019638 AGACAGAGTGAGACTCTGTCTGG + Intergenic
1028545363 7:91993206-91993228 CAACAGAGCAAGACCCTGTATGG - Intronic
1028592334 7:92511157-92511179 CAGCAGAGTGAGACCCTGTTGGG - Intronic
1028716575 7:93978089-93978111 CAACAGAGTGACACCCTGTCTGG - Intronic
1029030498 7:97461530-97461552 CAACGGAGTGAGACTCTGTCTGG + Intergenic
1029161594 7:98556223-98556245 CAACAGAGACAGACTGTTTCAGG + Intergenic
1029398842 7:100328445-100328467 AGACAGAGTAAGACCCTGTCTGG - Intergenic
1029599123 7:101553571-101553593 CAAGAGAGTGAGAAGGTGGCTGG + Intronic
1029625829 7:101719591-101719613 TGACAGAGTGAGACTTTGTCTGG - Intergenic
1029717474 7:102339497-102339519 AGACAGAGTAAGACCCTGTCTGG + Intergenic
1029733648 7:102453746-102453768 CGACAGAGTGAGACTCTATCTGG - Exonic
1029802541 7:102964420-102964442 CAACAGAGAGAGACTCAGTCTGG - Intronic
1030048806 7:105520850-105520872 CAACACAGCGAGACCCTGTGTGG + Intronic
1030652169 7:112128007-112128029 CAACAGAGCGAGACTCTGTCGGG + Intronic
1032209905 7:129904096-129904118 TGGCAGACTGAGACCGTGTCAGG - Intronic
1032248509 7:130233024-130233046 CAACAGAGTGAGACTCCATCTGG - Intergenic
1033114804 7:138615773-138615795 CGACAGAGTGAGACTCCGTCTGG + Intronic
1033138622 7:138805373-138805395 CAACAAAGTGAGACCCTGTCTGG + Exonic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1033507942 7:142024392-142024414 CGACAGAGTGAGACCCTGTCTGG + Intronic
1033541146 7:142357247-142357269 CGACAGAGTGAGACTCTGTCTGG - Intergenic
1034079714 7:148265291-148265313 TGACAGAGTGAGACCCTGTCTGG - Intronic
1034105831 7:148488984-148489006 CAACAGAGAGAGACCCTGTCTGG - Intergenic
1034482529 7:151333595-151333617 CAACAGAGTGAGACCTTGTCCGG + Intergenic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1035772412 8:2158389-2158411 CAACAGAGCGAGAATCTGTCAGG - Intronic
1036369797 8:8153240-8153262 TGACAGAGTGAGACCCTGTATGG - Intergenic
1036404884 8:8445906-8445928 CGACAGAGTGAGACCCTGTCTGG + Intergenic
1036510432 8:9395025-9395047 CAATATGGTGAGACCTTGTCTGG - Intergenic
1036881094 8:12512404-12512426 TGACAGAGTGAGACCCTGTATGG + Intergenic
1036951109 8:13140250-13140272 TAACAGAGCAAGATCGTGTCTGG - Intronic
1036977231 8:13427301-13427323 GAACAGAATGAGCCAGTGTCGGG - Intronic
1037174645 8:15932598-15932620 CAACAAAGTGAGACTCTGTCTGG - Intergenic
1037317119 8:17609453-17609475 CGACAGAGCGAGACTCTGTCTGG + Intronic
1037822948 8:22144030-22144052 CAGCAGAGTGCCAGCGTGTCTGG + Intergenic
1037847322 8:22295057-22295079 CAACAGAGCGAGACTTCGTCTGG + Intronic
1037856750 8:22376856-22376878 CAACAGAGTGAGACAATGTCTGG + Intronic
1037942236 8:22960336-22960358 CAACAGAGCAAGACTCTGTCAGG - Intronic
1038095105 8:24300434-24300456 CGACAGAGCGAGACTCTGTCTGG - Intronic
1038136288 8:24789928-24789950 CAACAGAGTGAGACTCTGACTGG - Intergenic
1038281216 8:26166806-26166828 TAACAGAGTGAGACCCTGTCTGG + Intergenic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1039250714 8:35661076-35661098 TGACAGAGTGAGACCCTATCAGG + Intronic
1039449939 8:37664693-37664715 CAGCAGAGTGAAACCCTGTCTGG - Intergenic
1039990049 8:42479803-42479825 TGACGGAGTGAGACCTTGTCTGG + Intronic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040798203 8:51311325-51311347 CAACATGGTGAAACCCTGTCTGG - Intergenic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1041646940 8:60262662-60262684 CAACATAGTGAGACCCTTTCAGG + Intronic
1042562594 8:70084209-70084231 AGACAGAGTGAGACTCTGTCTGG - Intergenic
1043110567 8:76175087-76175109 CAACAGAGCGAGACTCTTTCTGG - Intergenic
1043413453 8:80024207-80024229 CAACAGAGCAAGACCCTGTCTGG + Intronic
1044241062 8:89889041-89889063 CAACAAAGTGAGACCCTGTGTGG + Intergenic
1044434921 8:92150806-92150828 CAACAGAGTAAGACTCTGTCTGG + Intergenic
1044741777 8:95335139-95335161 CAACACAATGAGAACATGTCTGG - Intergenic
1044778622 8:95720840-95720862 CAACAGAGTGAGACTCTGCCAGG - Intergenic
1044973152 8:97639317-97639339 CGACAGAGTGAGACCTTGTCTGG - Intergenic
1045085003 8:98672360-98672382 CAACAGAGAGAAACCTTGTATGG + Intronic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1045764027 8:105646029-105646051 CAACAGAGTGAGACTCCATCTGG + Intronic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1047281048 8:123446011-123446033 TGACAGAGTGAGACTCTGTCTGG - Intronic
1047523888 8:125616163-125616185 CAACAGAGTGAGACTCTGTCTGG + Intergenic
1047744403 8:127833476-127833498 CGACAGAGCAAGACCCTGTCTGG - Intergenic
1049099373 8:140568262-140568284 TGACAGAGCGAGACCATGTCTGG + Intronic
1049498203 8:142946610-142946632 CCTCCGAGTGAGACTGTGTCTGG - Intergenic
1049677328 8:143896909-143896931 CAACAGAACAAGACCCTGTCTGG - Intergenic
1049806113 8:144540776-144540798 CAATACAGTGAGAACCTGTCTGG + Intronic
1049824243 8:144657438-144657460 CAACAGAGTGAGACCCTGTCTGG + Intergenic
1050562504 9:6848647-6848669 CGACAGAGTGAGACTGTCTCAGG + Intronic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1050573294 9:6964932-6964954 CTACAGAGTGAGACTTCGTCGGG + Intronic
1051755019 9:20389757-20389779 CAACACAGTGAGACCCCGTCCGG + Intronic
1051936529 9:22448126-22448148 CAACAGAGTGAGATCCTGTCTGG - Intronic
1053039846 9:34861154-34861176 TAACAGAATGAGACCCTGTAAGG + Intergenic
1053321060 9:37099225-37099247 GGACAGAGTGAAACTGTGTCTGG - Intergenic
1053358609 9:37466906-37466928 CAACAGAGTGAGATTTCGTCTGG + Intergenic
1053505746 9:38641946-38641968 CGACAGAGTGAGACCTAGTCTGG - Intergenic
1054725643 9:68647383-68647405 CAACATGGTGAAACCCTGTCTGG - Intergenic
1054786746 9:69217520-69217542 CAACCTAGTGAGACCCTGTTGGG + Intronic
1054913916 9:70478770-70478792 TGACAGAGTGAGACCCTGTCTGG + Intergenic
1054924397 9:70574959-70574981 TGACAGAGTGAGACCCTGTTGGG - Intronic
1055191232 9:73527409-73527431 CAACAGAGTGAGACCCTGTCTGG - Intergenic
1056165018 9:83932604-83932626 CAACAGAAGGAGACTCTGTCTGG + Intergenic
1056394607 9:86170094-86170116 CGACAGAGTGAGACTCTGCCTGG - Intergenic
1056400839 9:86225668-86225690 CAACATGGTGAAACCCTGTCTGG - Intronic
1056537393 9:87541527-87541549 CAACAGAGCAAGACTCTGTCTGG + Intronic
1056637224 9:88341343-88341365 CAACAGAGTGAGACTCTGTCTGG - Intergenic
1056987991 9:91382341-91382363 CAACAGAGCGAGACTCCGTCTGG + Intergenic
1057308510 9:93926575-93926597 CAACAGAGCAAGACCCTGTCTGG + Intergenic
1057465986 9:95315243-95315265 CAGCAGACTGAGACCGTGTCTGG - Intronic
1057620465 9:96630111-96630133 CCACAGAGTGAGACTCTATCGGG + Intergenic
1057684939 9:97222708-97222730 CAGCAGAGGAAGACCGGGTCAGG - Intergenic
1058007860 9:99938765-99938787 TGACAGTGTGAGACCTTGTCTGG + Intronic
1058458057 9:105156530-105156552 CAACAGAGTGAGACTCCATCTGG + Intergenic
1058759979 9:108121056-108121078 CAACAGAGTGAGACCCTGTCTGG + Intergenic
1058891681 9:109366456-109366478 CAACAGAGCCAGACCCTGTCTGG - Intergenic
1059079612 9:111234183-111234205 CAACAGAGTGAGACCCTATCAGG + Intergenic
1059132987 9:111774316-111774338 TGACAGAGTGAGACCCTGTCTGG - Intronic
1059626776 9:116075420-116075442 CAACAGAGTGAGAAGGGGTTAGG - Intergenic
1059721513 9:116964481-116964503 CAACACTGTGAGACCGTGGCAGG + Intronic
1060470503 9:123944107-123944129 CAACAGAGCAAGACTGTGTCAGG + Intergenic
1060775431 9:126370400-126370422 CAACAGAACGAGACTCTGTCTGG - Intronic
1061213559 9:129207291-129207313 CAAAAGGGATAGACCGTGTCAGG - Intergenic
1061660082 9:132124265-132124287 TAACAGAGTGAGATCCTGTCTGG + Intergenic
1062002359 9:134222846-134222868 TGACAGAGTGAGACCCTGTCAGG - Intergenic
1062593490 9:137286419-137286441 CAACCGAGTGAAACTCTGTCTGG - Intergenic
1062664578 9:137662215-137662237 TGACAGAGTGAAACCCTGTCTGG - Intronic
1062719476 9:138029628-138029650 CGACAGAGCGAGACCCTGTCTGG - Intronic
1185602363 X:1349025-1349047 CAACAGAGCAAGACCGTGTCAGG - Intronic
1185713632 X:2324035-2324057 TAACAGATGGAGACCCTGTCTGG + Intronic
1185767703 X:2739066-2739088 CAACATAGTGAGACCCTGTCTGG - Intronic
1186512471 X:10140258-10140280 TGACAGAGTGAGACCCTGTCTGG - Intronic
1186829384 X:13375707-13375729 CAACAGAGCGGGACCCTGTCTGG - Intergenic
1186873426 X:13794202-13794224 TAACAGAGTGAGATTGTATCTGG - Intronic
1187134528 X:16534322-16534344 CAACAGAGCGAGACTCCGTCTGG - Intergenic
1187315246 X:18186945-18186967 CAACAGAGCAAGACCCTGTCTGG + Intronic
1187390219 X:18881388-18881410 CGACAGAGTGAGACTCTGTCTGG + Intergenic
1187468493 X:19547133-19547155 CAAAAGAGTGGGACCCTGTCTGG + Intronic
1187707222 X:22020755-22020777 TGACAAAGTGAGACTGTGTCAGG - Intergenic
1187717128 X:22113967-22113989 CAATAGAGTGAGACTCTGTCTGG - Intronic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1188550791 X:31362652-31362674 CAACAGAGTAAGGCCGGGTGCGG + Intronic
1189341345 X:40206864-40206886 CGACAGAGTGAGACGCCGTCTGG + Intergenic
1189464782 X:41270088-41270110 CGACAGAGTGAGACCCTGTCCGG - Intergenic
1189828394 X:44944330-44944352 CAACAGAGTGAAACTCTGTTAGG + Intronic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190016923 X:46835456-46835478 CAACACAGTGAAACCCCGTCTGG - Intergenic
1190023767 X:46903665-46903687 CAGCAGAGTGAGACTGAGTAGGG + Intergenic
1190230794 X:48580414-48580436 AGACAGAGTGAGACCCTGTCTGG - Intergenic
1190341651 X:49301609-49301631 CAACAGAGTGAGACTCTGTCTGG - Intergenic
1190489718 X:50969541-50969563 CAACATAGCGAGACTGTGGCAGG - Intergenic
1190642521 X:52494667-52494689 CAACAGAGTGACACTCTGTCTGG + Intergenic
1190645152 X:52518200-52518222 CAACAGAGTGACACTCTGTCTGG - Intronic
1190846086 X:54191981-54192003 TGACAGAATGAGACCTTGTCTGG + Intergenic
1190890587 X:54563764-54563786 CAACAGAGTGAGACTGTCTCAGG + Intergenic
1192088588 X:68128067-68128089 TGACAGAGTGAGACCCTTTCTGG - Intronic
1192331176 X:70176487-70176509 CGACACAGTGAGACTCTGTCTGG + Intergenic
1192790105 X:74373194-74373216 CCACAGAGCGAGACCCTGGCTGG + Intergenic
1193664998 X:84305379-84305401 CAAAAGAGTGAGAACATGTGAGG - Intergenic
1194323981 X:92487957-92487979 CAACAGAGTGAGACGCCATCTGG - Intronic
1194715989 X:97287283-97287305 CAACAGAGTGAAACTCCGTCGGG + Intronic
1196369308 X:114957878-114957900 CAACAGAGAAAGACCCTGACTGG + Intergenic
1196421589 X:115527750-115527772 CAACAGAGCAAGACCATGTCTGG + Intergenic
1197555017 X:127942259-127942281 CAACACAGCAAGACCCTGTCTGG + Intergenic
1197731229 X:129812101-129812123 CAACAGAATGAGACTCTGTCTGG - Intronic
1197755265 X:129989484-129989506 CAACAGAGCTAGACTGTCTCCGG - Intronic
1198248155 X:134851514-134851536 CAACAGAGTAAGACTCTGTCTGG + Intronic
1198249699 X:134868122-134868144 CAGCAGAGTGAGACCGGGTGCGG - Intergenic
1198375174 X:136031637-136031659 CAACAGAGCGAGACTCTGTCTGG + Intronic
1200095279 X:153656510-153656532 TGACTGAGTGAGACCCTGTCTGG + Intergenic
1201325596 Y:12754244-12754266 GAACAGATTGAGGCCCTGTCTGG - Intronic
1201342207 Y:12946923-12946945 CAACAGAGTGAGACTCCATCTGG - Intergenic