ID: 1155270697

View in Genome Browser
Species Human (GRCh38)
Location 18:24139058-24139080
Sequence CCCCTTGCCGGCGGCTCCTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 198}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155270697_1155270707 20 Left 1155270697 18:24139058-24139080 CCTCAGGAGCCGCCGGCAAGGGG 0: 1
1: 0
2: 1
3: 11
4: 198
Right 1155270707 18:24139101-24139123 AGCGCGGCCGGAAAGCAGGTGGG 0: 1
1: 0
2: 1
3: 8
4: 69
1155270697_1155270708 21 Left 1155270697 18:24139058-24139080 CCTCAGGAGCCGCCGGCAAGGGG 0: 1
1: 0
2: 1
3: 11
4: 198
Right 1155270708 18:24139102-24139124 GCGCGGCCGGAAAGCAGGTGGGG 0: 1
1: 0
2: 0
3: 10
4: 111
1155270697_1155270710 30 Left 1155270697 18:24139058-24139080 CCTCAGGAGCCGCCGGCAAGGGG 0: 1
1: 0
2: 1
3: 11
4: 198
Right 1155270710 18:24139111-24139133 GAAAGCAGGTGGGGAGAATCTGG 0: 1
1: 0
2: 3
3: 35
4: 341
1155270697_1155270706 19 Left 1155270697 18:24139058-24139080 CCTCAGGAGCCGCCGGCAAGGGG 0: 1
1: 0
2: 1
3: 11
4: 198
Right 1155270706 18:24139100-24139122 GAGCGCGGCCGGAAAGCAGGTGG 0: 1
1: 0
2: 1
3: 8
4: 154
1155270697_1155270703 4 Left 1155270697 18:24139058-24139080 CCTCAGGAGCCGCCGGCAAGGGG 0: 1
1: 0
2: 1
3: 11
4: 198
Right 1155270703 18:24139085-24139107 CGAGGAAGCTCTTAAGAGCGCGG 0: 1
1: 0
2: 0
3: 2
4: 48
1155270697_1155270704 8 Left 1155270697 18:24139058-24139080 CCTCAGGAGCCGCCGGCAAGGGG 0: 1
1: 0
2: 1
3: 11
4: 198
Right 1155270704 18:24139089-24139111 GAAGCTCTTAAGAGCGCGGCCGG 0: 1
1: 0
2: 1
3: 4
4: 39
1155270697_1155270705 16 Left 1155270697 18:24139058-24139080 CCTCAGGAGCCGCCGGCAAGGGG 0: 1
1: 0
2: 1
3: 11
4: 198
Right 1155270705 18:24139097-24139119 TAAGAGCGCGGCCGGAAAGCAGG 0: 1
1: 0
2: 0
3: 3
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155270697 Original CRISPR CCCCTTGCCGGCGGCTCCTG AGG (reversed) Exonic
900116047 1:1028343-1028365 CACCTGGCTGGCGGCACCTGTGG + Intronic
900398701 1:2464015-2464037 CCCCTTGCTGGCAGCCCCAGAGG + Intronic
900519682 1:3099516-3099538 CATCCTGCGGGCGGCTCCTGGGG + Intronic
900621979 1:3591729-3591751 CCCCTTGCCGGCGCCCCCATCGG - Intronic
900912588 1:5612135-5612157 CCCTTTTCCTGCAGCTCCTGTGG - Intergenic
903067608 1:20709537-20709559 CCACTTTCCAGGGGCTCCTGCGG + Intronic
903123707 1:21233527-21233549 CACCTTGCCGGCAGGGCCTGGGG + Intronic
903657743 1:24959404-24959426 CCCTTTGATGGCGGCTTCTGAGG - Intronic
903738309 1:25544034-25544056 CCCCATGCCGGCTGCACCTGAGG - Intronic
904120405 1:28194220-28194242 CCCCAGGCTGGGGGCTCCTGAGG - Intergenic
907627392 1:56043499-56043521 CCCCTTGCTGGAGGGTCCTATGG + Intergenic
907902635 1:58755056-58755078 TCCCTTGCAGGCTGCTTCTGTGG + Intergenic
912492221 1:110068856-110068878 ACCCTTGCCGTCGGATCCCGGGG + Intronic
912933693 1:113985086-113985108 CCCCTTCCCCAAGGCTCCTGGGG + Intergenic
913098926 1:115545444-115545466 CCTCTGGCCTGTGGCTCCTGTGG - Intergenic
915463497 1:156082772-156082794 CCCCGCGCCGGCCGGTCCTGGGG + Intronic
1064028804 10:11869991-11870013 CCCCTCGCCGGCGTCCCCCGCGG - Exonic
1069957862 10:72062733-72062755 CCCCCGGCAGCCGGCTCCTGAGG + Exonic
1072102256 10:92240052-92240074 CCCGGTGCCGCGGGCTCCTGAGG + Exonic
1072757422 10:98030363-98030385 ACCCTTGCGGGCGGATCCGGGGG + Intronic
1072766120 10:98096505-98096527 CCTCCTGCCCGGGGCTCCTGGGG + Intergenic
1075716430 10:124558417-124558439 CCCCTTGCCGGTGGGACCTTGGG - Intronic
1076604970 10:131683502-131683524 CGCCTTGCCGGGGGCCCCTGGGG + Intergenic
1077076758 11:705712-705734 CCCCATGCCTGGGGCACCTGAGG + Intronic
1077308030 11:1876559-1876581 CCCCCTGCAGGCAGCTCCTGTGG - Intronic
1077485796 11:2837838-2837860 TCCCTCGCCGCCGGCCCCTGTGG - Intronic
1078063225 11:8061551-8061573 CCCCTTGCCCTGGGATCCTGGGG + Intronic
1078830753 11:14974258-14974280 CGCCCTGCCGGCGGACCCTGCGG - Intronic
1080503050 11:32888290-32888312 CCCCCTGCTGTGGGCTCCTGTGG - Intergenic
1080944765 11:36958605-36958627 CAGCTTGCCGGGAGCTCCTGTGG + Intergenic
1081700145 11:45147364-45147386 CCCCGCGCCGGGGGCTGCTGCGG + Exonic
1083255764 11:61494538-61494560 CCCCTGGCCTGCTGCTCCTCTGG - Intergenic
1083860914 11:65419488-65419510 CCCTTTTCCAGGGGCTCCTGTGG + Intergenic
1084008395 11:66334932-66334954 CCCCTTGCCAGCTGCTACGGAGG - Exonic
1084220353 11:67674154-67674176 CCCCATCCCTGGGGCTCCTGGGG + Intronic
1084366919 11:68707704-68707726 CCCATTGCCTGCGTCTCCCGGGG + Exonic
1084705081 11:70811385-70811407 TCCCTTGCCGGCTGCTGTTGAGG - Intronic
1084797491 11:71518588-71518610 CTGCTTGGCGGCGCCTCCTGCGG + Intronic
1089615037 11:119690536-119690558 CCCTTTGGTGGGGGCTCCTGAGG - Intronic
1092002565 12:5044283-5044305 CCCTTTGGCGCCGGCTCCTTGGG - Exonic
1096979741 12:55721551-55721573 GCCCTTGCAGGTGACTCCTGGGG - Intronic
1097017882 12:56000225-56000247 CCCTTCGCCGTGGGCTCCTGTGG - Intronic
1098514606 12:71359137-71359159 CCCCTTGCCTAAGGCTCCTCAGG + Intronic
1100444800 12:94650506-94650528 CCCCTCGCCCGCGGCTCCCAGGG - Exonic
1103950908 12:124550478-124550500 CCCCCTGCCAGTGGCTGCTGGGG - Intronic
1104376535 12:128268395-128268417 CGCCTGCCCCGCGGCTCCTGGGG - Intronic
1104952205 12:132446290-132446312 ACCCTTCCCAGCCGCTCCTGTGG + Intergenic
1104955172 12:132461226-132461248 CCCCCTTCCAGCTGCTCCTGAGG + Intergenic
1104966352 12:132510256-132510278 CACCCTGCCGGCCTCTCCTGGGG + Intronic
1105004296 12:132711253-132711275 ACCCTTCCCGCCGGCTTCTGTGG + Intronic
1106244247 13:27933742-27933764 CCCCTTGCCTTAGCCTCCTGTGG + Intergenic
1109575418 13:64250100-64250122 CCCCTTCCCTAAGGCTCCTGTGG + Intergenic
1112449151 13:99493598-99493620 CCCCTTGCCAAGTGCTCCTGAGG - Intergenic
1113093559 13:106639360-106639382 CGCCTTGCTGGAGGCTCCAGTGG - Intergenic
1113517595 13:110915174-110915196 CCCCTGCCCGGCGGCTCCAGAGG - Intergenic
1113795013 13:113051760-113051782 CCTCTTGCTGGTGGGTCCTGAGG + Intronic
1113885496 13:113656582-113656604 CCCATTCCCGCCAGCTCCTGGGG + Intronic
1115314640 14:32013201-32013223 CCCATTCCTGGCGGTTCCTGAGG + Intronic
1118715522 14:68556945-68556967 CCCAATGCCGGGGACTCCTGAGG - Intronic
1118736353 14:68704327-68704349 CCCCTTCCGGGCTCCTCCTGCGG - Intronic
1118777069 14:68979629-68979651 TCCAATCCCGGCGGCTCCTGGGG - Intergenic
1119290535 14:73491602-73491624 CCGCTCGCCGCCGGCTGCTGGGG - Exonic
1121121687 14:91379754-91379776 CCCCGTGCCCGGGCCTCCTGCGG + Intronic
1121215275 14:92242733-92242755 CCCCTTGCCTGAGCCTCCTCTGG - Intergenic
1122315929 14:100826160-100826182 GGCCTTGGCGGCGGCTCCTCAGG + Intergenic
1122447712 14:101781627-101781649 GCCCATGCCGGAGGCTCCGGAGG - Intronic
1122706813 14:103627053-103627075 CACCTCGCCGGCCTCTCCTGGGG + Intronic
1122853367 14:104548413-104548435 CCCCTCTGCAGCGGCTCCTGGGG - Intronic
1122919821 14:104875419-104875441 CCCCAGGCCTGTGGCTCCTGAGG + Intronic
1122975874 14:105170504-105170526 CCCCGGGCTGGGGGCTCCTGAGG - Intergenic
1123004376 14:105314438-105314460 GCCCTTGCCCGCGGCTCCCGGGG + Exonic
1127103245 15:55588231-55588253 TCCCCTGTCAGCGGCTCCTGAGG - Intronic
1127774494 15:62254538-62254560 CCCCCTGCTGGGGGCTCCAGGGG + Intergenic
1128300703 15:66564827-66564849 CCCCCTGCAGGCTTCTCCTGGGG - Exonic
1129221922 15:74136142-74136164 CCCCTTGGCGGCTGAGCCTGTGG + Exonic
1129295839 15:74599597-74599619 CACTTTGCCTGTGGCTCCTGAGG + Intronic
1129324745 15:74794122-74794144 CCCCTTGCCCCTGCCTCCTGTGG - Intronic
1129324762 15:74794177-74794199 CCCCTTGCCCCTGCCTCCTGTGG - Intronic
1129324781 15:74794232-74794254 CCCCTTGCCCCTGCCTCCTGTGG - Intronic
1129324823 15:74794342-74794364 CCCCTTGCCCCTGCCTCCTGTGG - Intronic
1131059009 15:89392994-89393016 TCCCTTGAGGGCAGCTCCTGAGG + Intergenic
1131070762 15:89464321-89464343 CCCCTTGCCAAGTGCTCCTGAGG + Intergenic
1135074973 16:19385281-19385303 CCCTTTGCCTCCAGCTCCTGGGG + Intergenic
1136268353 16:29133662-29133684 CCCCTGGGCAGCGGCTCCTCTGG - Intergenic
1136778845 16:32885145-32885167 CCCCTCCGCGGCGGCTCCGGGGG + Intergenic
1136891773 16:33976373-33976395 CCCCTCCGCGGCGGCTCCGGGGG - Intergenic
1137274333 16:46923642-46923664 CACTTGGCCGGCGGCACCTGTGG + Intronic
1140473937 16:75229305-75229327 CCCCTGGGCTTCGGCTCCTGAGG + Exonic
1142071662 16:88093996-88094018 CCCCTGGGCAGCGGCTCCTCTGG - Intronic
1142317045 16:89354097-89354119 GACCTTGCAGGCGGCACCTGAGG - Intronic
1142779805 17:2172690-2172712 CCCCTTGCTGGCTGCCCCTCAGG - Exonic
1143437455 17:6939824-6939846 CCCCTTGCCAAGTGCTCCTGAGG - Intronic
1143446726 17:7014364-7014386 ACCCTTGCCGGCGCCCTCTGCGG + Exonic
1143586881 17:7854896-7854918 CCCCTCCCCGGAGGCGCCTGTGG + Intergenic
1143782060 17:9234110-9234132 CCCCATGTGGGCGTCTCCTGTGG + Intronic
1145284410 17:21494714-21494736 CTCCTTTCTGGGGGCTCCTGGGG + Intergenic
1145393046 17:22470777-22470799 CTCCTTTCTGGGGGCTCCTGGGG - Intergenic
1146124764 17:30222834-30222856 CCACTTGCCAGCAACTCCTGTGG + Exonic
1146256263 17:31392782-31392804 CCCCATGCCGGTGGCACCAGAGG - Intronic
1147139583 17:38453781-38453803 CCCCGGGCCCGCGGCTCCGGGGG + Intronic
1147819190 17:43231621-43231643 CCCTGTGCCTGCGTCTCCTGCGG + Intergenic
1147819776 17:43234652-43234674 CCCTGTGCCTGCGTCTCCTGCGG + Intergenic
1147821088 17:43242050-43242072 CCCTGTGCCTGCGTCTCCTGCGG + Intergenic
1147821894 17:43246539-43246561 CCCTGTGCCTGCGTCTCCTGCGG + Intergenic
1147825496 17:43267498-43267520 CCCTGTGCCTGCGTCTCCTGCGG + Intergenic
1147826627 17:43273965-43273987 CCCTGTGCCTGCGTCTCCTGCGG + Intergenic
1147827516 17:43278843-43278865 CCCTGTGCCTGCGTCTCCTGCGG + Intergenic
1147828624 17:43285004-43285026 CCCTGTGCCTGCGTCTCCTGCGG + Intergenic
1147830811 17:43297277-43297299 CCCTGTGCCTGCGTCTCCTGCGG + Intergenic
1147831510 17:43300906-43300928 CCCTGTGCCTGCGTCTCCTGCGG + Intergenic
1147843460 17:43388795-43388817 CCCTGTGCCTGCGTCTCCTGCGG + Intergenic
1149481296 17:57005467-57005489 CACCTTGCCTGTGCCTCCTGGGG + Intronic
1151169535 17:72235273-72235295 CCCCTTGAAGGCTGCCCCTGAGG - Intergenic
1152140700 17:78534767-78534789 CCCCTTGCTGGTGTCCCCTGTGG + Intronic
1152356491 17:79810106-79810128 CCCCTCCCCGCCGGCTCCCGGGG + Intergenic
1155270697 18:24139058-24139080 CCCCTTGCCGGCGGCTCCTGAGG - Exonic
1157552966 18:48594152-48594174 CCCTTTTCCGGCGGGTCCTGGGG + Intronic
1159480851 18:68989597-68989619 CCCCCTGCCTGAGGCTCATGAGG - Intronic
1160838783 19:1137083-1137105 TCCCTTGCCGCCTGTTCCTGGGG - Intronic
1162299388 19:9835572-9835594 AGGCTTCCCGGCGGCTCCTGAGG - Intronic
1163592605 19:18202972-18202994 CCCCTTGAAGGGGGCTGCTGGGG - Intronic
1166543412 19:43620204-43620226 CCCCATGCTGGCGGATTCTGTGG + Intergenic
1168666638 19:58209667-58209689 TCCCTTTCCGGGGGCTGCTGAGG - Intronic
925088699 2:1134945-1134967 CCCCTGGCCAGCGGCTGCGGAGG - Intronic
925290741 2:2746911-2746933 CCCATTGCGGGCTGCTTCTGTGG + Intergenic
927516970 2:23677519-23677541 CCACCTGCGGGCGGCACCTGTGG - Intronic
931254057 2:60554972-60554994 GCCTTGGCCGGCGGCGCCTGGGG - Intergenic
935094862 2:99934668-99934690 CCCCTTCCCAGTGGCTTCTGAGG - Intronic
935237626 2:101151524-101151546 CCCCTACCCCGCGGCTCCCGCGG + Intronic
937040963 2:118820325-118820347 CCCTTTGCTGGTGACTCCTGGGG + Intergenic
945119614 2:206443915-206443937 AGCCTTGCCGGCGCTTCCTGCGG + Exonic
947435436 2:230068443-230068465 CCCCTTCCCGGGGGTCCCTGGGG + Intronic
949044598 2:241866691-241866713 CCCCTTGCCGGTGGGGCCTGTGG + Intergenic
1171123106 20:22582405-22582427 GCCGCTGCCGGCGGCGCCTGCGG + Exonic
1171488287 20:25499158-25499180 CCACTTCCCAGCAGCTCCTGAGG + Intronic
1173253006 20:41374540-41374562 CCCCTTTCTGGCCCCTCCTGGGG - Intergenic
1173820162 20:46014282-46014304 CCCCCTGCCGGCGGCCGCGGCGG - Intronic
1175546844 20:59783757-59783779 CCCCTTGCTGCAGGCACCTGCGG - Intronic
1176374749 21:6081465-6081487 CCACCTGCGGGCGTCTCCTGGGG + Intergenic
1178263821 21:31124340-31124362 CTCCTTCCCAGTGGCTCCTGGGG - Intronic
1178875831 21:36413196-36413218 CCCCTTGCCGGGGCCTTCGGAGG + Exonic
1179616621 21:42587313-42587335 CCCCTTGCAGTCAGCACCTGAGG + Intergenic
1179748726 21:43456780-43456802 CCACCTGCGGGCGTCTCCTGGGG - Intergenic
1179809986 21:43864692-43864714 TCCCCTGCCGGGGTCTCCTGCGG - Intergenic
1180155209 21:45974274-45974296 CCCCGCGCCGCGGGCTCCTGTGG + Intergenic
1180211104 21:46295865-46295887 CCCCTTGCCCATTGCTCCTGCGG + Intronic
1183598824 22:38828344-38828366 GCCTCTGCCGGCGGCTGCTGTGG + Exonic
1184060743 22:42079615-42079637 CGCAGTGCCGGCGGCTCCTGGGG - Intergenic
1184720278 22:46308694-46308716 CCCCTTGCTGGGGCCCCCTGTGG + Exonic
1185173763 22:49307657-49307679 CCCCTTCCCTGGGGCTTCTGGGG - Intergenic
950653984 3:14425355-14425377 CCCAGTGCAGGCAGCTCCTGCGG - Intronic
950703552 3:14766553-14766575 CCCCTCGCCGGCTGCCCCTGAGG - Intronic
961584368 3:127910075-127910097 CCCCTTGCCCCCTCCTCCTGAGG - Intergenic
962249768 3:133828807-133828829 TCGCTGGCCGGGGGCTCCTGGGG + Exonic
968589146 4:1449089-1449111 CCCCCTGGCTGGGGCTCCTGGGG - Intergenic
968872581 4:3249272-3249294 CGCCATGCCGGAGGCGCCTGTGG - Exonic
969373468 4:6748387-6748409 CCACTGGCCTGCGGCTCCTGTGG + Intergenic
969429571 4:7146277-7146299 CCCATTGCTGTGGGCTCCTGAGG + Intergenic
969439431 4:7208534-7208556 TCCCTTGCCTGCGGCTGCCGGGG - Intronic
969559549 4:7938872-7938894 CCCCTGGCCGGCGGGCCCCGGGG - Intronic
972396390 4:38663301-38663323 CCCCTGGCCGGCGGCCCAGGCGG - Intergenic
974376343 4:61081693-61081715 TCTCTTGCTGGCAGCTCCTGGGG - Intergenic
974792733 4:66712495-66712517 CCCCTCTCCGTCGGCTCCTGTGG - Intergenic
976750116 4:88444946-88444968 CCCCTTGCCAAGTGCTCCTGAGG + Intergenic
978112234 4:104977078-104977100 CCCCTTGCTGGCGGCTCTGTGGG - Intergenic
981749698 4:148082001-148082023 CCCCTTGGCGGCAGCTCCATTGG - Intronic
982274952 4:153629130-153629152 CCCCATGCCAGCTGCCCCTGTGG + Intronic
985852421 5:2398339-2398361 CCCCTCACAGGAGGCTCCTGAGG - Intergenic
985996777 5:3601232-3601254 GCCTCTGCCGGCGGCTCCAGTGG + Exonic
987876588 5:23688426-23688448 ACCCTTTCCGGCGGCTCCCCAGG - Intergenic
988020482 5:25614638-25614660 CCCCCTGCAGTGGGCTCCTGTGG - Intergenic
990338582 5:54800390-54800412 CCCCTTGCCTGCGGCAGCTCAGG - Intergenic
990381950 5:55227438-55227460 CCCCGCGCTGGCGGCTCCCGGGG - Intergenic
998157502 5:139795312-139795334 TCCCTTGGCGGCGTCTCCCGGGG + Intergenic
1001704709 5:173733500-173733522 GCCCTTGCCAGCCACTCCTGAGG + Intergenic
1002081726 5:176741403-176741425 CTTCTTGCAGGCGGCTCCTCAGG - Intergenic
1002660016 5:180785509-180785531 CCCCTTGCTGGAGGGTTCTGGGG - Intergenic
1003115373 6:3280403-3280425 TCCCATGCCGGCAGCGCCTGTGG - Intronic
1003482561 6:6546698-6546720 TCCCTTGCCACCGGCTCCCGCGG + Intergenic
1004534627 6:16488491-16488513 CACCTTGCTTGCGGCTCATGTGG - Intronic
1006071259 6:31499208-31499230 CCCCTCGCCTCCGGCTCCGGGGG + Intronic
1007533577 6:42564429-42564451 CCCCTCGCAGGCCGCGCCTGTGG + Intronic
1010242885 6:73633092-73633114 CCCCTTGCCTCAGCCTCCTGAGG + Intronic
1013575839 6:111483071-111483093 CCCCTTGCCGGGTGCTCCTGAGG - Exonic
1014947583 6:127516031-127516053 CCCCTGGGCGGCGGCGGCTGCGG + Exonic
1019049922 6:169175012-169175034 CCCCTGCCCTGCGGCTCCTACGG + Intergenic
1019649151 7:2147250-2147272 CCTCTTGCCTGCAGGTCCTGGGG - Intronic
1020130501 7:5556338-5556360 CCCCCGGCCCGCGGCCCCTGTGG + Intronic
1022523972 7:31025631-31025653 CACCCTGCCTGCAGCTCCTGAGG - Intergenic
1029264302 7:99326135-99326157 CTCCCTGCCGGGGCCTCCTGAGG + Intronic
1029865094 7:103619432-103619454 CCACTTGCCTGTGTCTCCTGTGG + Intronic
1030676842 7:112393358-112393380 CCCCTTGCTGTAGGCTCCTTGGG + Intergenic
1035553067 8:544829-544851 CGCTCTGCCTGCGGCTCCTGCGG + Exonic
1035859833 8:3015923-3015945 CCCCTTGCATGCGCCTCCAGAGG + Intronic
1038828570 8:31033218-31033240 CCCCTGCCCGGCTGCTCCGGCGG - Exonic
1045411572 8:101925949-101925971 CCCATTGCAGGGGACTCCTGAGG - Intronic
1049234729 8:141506924-141506946 ACCCCTGCAGGCTGCTCCTGGGG + Intergenic
1049569093 8:143360017-143360039 CCCCTTCCCGGCAGCACCGGCGG - Intergenic
1049578644 8:143400935-143400957 CCCCTTGCCGATGGATGCTGTGG - Intergenic
1050350994 9:4741184-4741206 CCACTAGCAGGCGGCTACTGCGG + Exonic
1053300684 9:36947168-36947190 CCCCTTCCTGGCAGCTCCAGAGG + Intronic
1054532673 9:66198636-66198658 ACCCCTGCTGGCGTCTCCTGAGG - Intergenic
1054813748 9:69455347-69455369 CCCCTGGGAGGCGGCTTCTGAGG + Intronic
1061866736 9:133495129-133495151 CCCCATCACCGCGGCTCCTGGGG - Intergenic
1062312375 9:135945845-135945867 TCCCTTGCCGGAGACACCTGGGG - Intronic
1190333665 X:49250257-49250279 ACCTCTGCCGGCGGCTCCTCAGG - Exonic
1192034168 X:67545556-67545578 CCCCTTGCTGGCGGCCACGGCGG - Exonic
1197794048 X:130281974-130281996 CCCCTTGCCAAGTGCTCCTGAGG + Intergenic
1198283782 X:135170638-135170660 ACCCCTGCCGGCGACTGCTGAGG - Intronic
1200100953 X:153688895-153688917 CCCCTCCGCGGCGGCTCCGGGGG - Intronic
1200231023 X:154443979-154444001 GCCCCCGCCGCCGGCTCCTGTGG - Intergenic