ID: 1155271072

View in Genome Browser
Species Human (GRCh38)
Location 18:24141702-24141724
Sequence GACTCCTAAAAAATCACCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 137}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155271072_1155271074 10 Left 1155271072 18:24141702-24141724 CCTTAGGTGATTTTTTAGGAGTC 0: 1
1: 0
2: 0
3: 5
4: 137
Right 1155271074 18:24141735-24141757 CACCCTGACACAGTTTCAGGTGG 0: 1
1: 0
2: 0
3: 19
4: 199
1155271072_1155271073 7 Left 1155271072 18:24141702-24141724 CCTTAGGTGATTTTTTAGGAGTC 0: 1
1: 0
2: 0
3: 5
4: 137
Right 1155271073 18:24141732-24141754 ATACACCCTGACACAGTTTCAGG 0: 1
1: 0
2: 0
3: 8
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155271072 Original CRISPR GACTCCTAAAAAATCACCTA AGG (reversed) Intronic
905082208 1:35333557-35333579 TACTCTTAAAAAATCATATATGG - Intronic
914939369 1:152009012-152009034 GACTCCTAGACAATAACATAGGG - Intergenic
915408317 1:155679661-155679683 GACTCCTACAAACCCACATATGG + Intronic
916949443 1:169764074-169764096 TAGTCCTTAAAAGTCACCTAAGG - Intronic
920003963 1:202819121-202819143 GACTCGGATAAAATCACCCAGGG + Intergenic
923508506 1:234627872-234627894 GACTCCTTAATCATCACCTCTGG - Intergenic
923693830 1:236226169-236226191 GACTCCTAAAAGTTAACCGAGGG - Intronic
1063799631 10:9559456-9559478 AACTTTTAAAAATTCACCTAAGG + Intergenic
1065759328 10:28967257-28967279 GTCTCCTGAAAAATGACATAAGG - Intergenic
1071427954 10:85578476-85578498 CAATCCTAAAAAAGCACATAAGG + Intergenic
1072968659 10:99997409-99997431 GACTCCTCAGAAATGACCTTGGG + Intronic
1073751780 10:106537099-106537121 GAATCCTAATAAATAACATATGG + Intergenic
1075510885 10:123072351-123072373 GGCTCCCAAGATATCACCTACGG - Intergenic
1078933591 11:15932685-15932707 CACAGCTACAAAATCACCTAAGG + Intergenic
1079685846 11:23358859-23358881 GACTCCTAAAAAATTAACTTGGG + Intergenic
1081537793 11:44007912-44007934 GACTCCTAAAACAGCACACAGGG + Intergenic
1087431093 11:98056250-98056272 GACACCAAAAATATGACCTATGG - Intergenic
1088218174 11:107537038-107537060 GAGGCCTGAAAAATCACATAGGG + Intronic
1089121059 11:116135501-116135523 GAATCTTAAAATGTCACCTATGG - Intergenic
1092667307 12:10816839-10816861 GACTCCTAGAGAAGCTCCTAAGG - Intergenic
1093311367 12:17590332-17590354 GTCTCCAAAATAATCACATATGG + Intergenic
1094752798 12:33432632-33432654 GACTACTAAAACATCACTAAGGG + Intronic
1099263673 12:80416814-80416836 GACTGCTAAAACATGAACTAAGG - Intronic
1106289768 13:28350021-28350043 GACTGCTGAGAAAACACCTAAGG - Intronic
1106342771 13:28847152-28847174 GCCTGCCAGAAAATCACCTAAGG + Intronic
1109199417 13:59413901-59413923 GACTCCCAAAAAAAGTCCTATGG + Intergenic
1111035259 13:82663724-82663746 GACTACATAAGAATCACCTAAGG - Intergenic
1111385132 13:87516136-87516158 GACACCAAAAAAATTACATATGG + Intergenic
1115488810 14:33938965-33938987 GAATAATAAAACATCACCTATGG + Intronic
1116969227 14:51047414-51047436 CATTCCTCAAAAGTCACCTATGG - Intronic
1118470663 14:66072346-66072368 GTCCCCTGACAAATCACCTAAGG - Intergenic
1122192559 14:100057771-100057793 GACTCCTAGAACCTCAACTATGG - Intronic
1122429718 14:101632666-101632688 GACCCCTCAAAAATCACGAAAGG + Intergenic
1126346323 15:47698005-47698027 GGATTCTAAAAGATCACCTATGG - Intronic
1126794615 15:52250056-52250078 GACTCCATAAAAAGCACATATGG - Intronic
1130847463 15:87760591-87760613 GACTCTTACTAAATGACCTAGGG - Intergenic
1131901944 15:97097520-97097542 GAATCCAGAAAACTCACCTATGG + Intergenic
1134153043 16:11820076-11820098 GACAACAAAAAAAGCACCTATGG + Intergenic
1135946749 16:26871902-26871924 CATTCCTAAAAGCTCACCTAGGG - Intergenic
1139934232 16:70556620-70556642 ACCTCCTGAAAAGTCACCTAGGG - Intronic
1147029291 17:37618204-37618226 TACTTCTAAAAATTTACCTAAGG + Intronic
1148443042 17:47721586-47721608 GCTTCCAAAAAAATCACCTGAGG - Intergenic
1149814788 17:59713191-59713213 GACACTTAAAGAATCATCTATGG + Intronic
1153607698 18:6851260-6851282 TTTTCCTTAAAAATCACCTAAGG - Intronic
1155271072 18:24141702-24141724 GACTCCTAAAAAATCACCTAAGG - Intronic
1155715750 18:28941600-28941622 GAATAATAAAAAATTACCTATGG + Intergenic
1157652830 18:49352758-49352780 GACTCTTAAGGAATCAACTATGG + Intronic
1158443474 18:57498593-57498615 GTCTCCTAAAAATTCAGCCAGGG - Intergenic
1158991799 18:62876216-62876238 GACTTCTAAAAAAAAATCTATGG + Intronic
1159962152 18:74563733-74563755 GCCTCCTAGAAAATAACCCAGGG - Intronic
1160173170 18:76571366-76571388 GATTCCTAAATAAACACCTGGGG + Intergenic
1162199643 19:9010954-9010976 GAGTCCTACAAAACCACCTCGGG + Intergenic
1164546235 19:29165751-29165773 GACTGCTGAAAAATGACCTATGG - Intergenic
1166535435 19:43571154-43571176 AACCCCTAAAAAACCACTTAAGG - Intronic
926290064 2:11521643-11521665 GAGGCCCAAAAAATCAGCTACGG + Intergenic
927050774 2:19326134-19326156 AACTCCTGAAAAATCCCTTAAGG + Intergenic
927476201 2:23416249-23416271 CACTTCTAGAAAAACACCTAGGG + Intronic
930757226 2:54988312-54988334 GTCTCCAAAAAAATCATCTTGGG + Intronic
937564150 2:123263074-123263096 CACTCCTACAAAATCAGTTAAGG - Intergenic
938373891 2:130791643-130791665 GACTCCTTAACAGTCACCTCTGG + Intergenic
940234636 2:151496639-151496661 GCCTCCTAAACAATCACATGAGG + Intronic
940234747 2:151497974-151497996 GCCTCCTAAACAATCACATGAGG + Intronic
943406575 2:187494617-187494639 GACTTTTAAAAACGCACCTAAGG - Intronic
945507221 2:210656671-210656693 CACTCAGAAAAAAACACCTAAGG + Intronic
948168900 2:235885106-235885128 CATTCCTAAAATACCACCTAGGG + Intronic
1169756805 20:9051732-9051754 GACTCATAGAAAATCTGCTATGG + Intergenic
1171315817 20:24193777-24193799 AACTCCTAAAAATTCTACTAAGG - Intergenic
1172475808 20:35236671-35236693 GACTTATTAAAAATCACCAAGGG + Intronic
1173737013 20:45369331-45369353 AGCTCCTAAAAAGTCACCTTGGG - Intronic
1177698198 21:24600964-24600986 AACTCCTAAAATAACACATATGG + Intergenic
1178933484 21:36840364-36840386 GACTCCAAAAATATCCTCTATGG + Intronic
1181383168 22:22523162-22523184 GACTGATAAAGAATCAGCTATGG - Intergenic
1182661690 22:31929587-31929609 GACTCATAAAAAATAACAAATGG - Intergenic
950814370 3:15684291-15684313 GACTCATAAAAGGTCACGTAGGG - Intronic
954319704 3:49823577-49823599 AACTCCTAAAAGATAACATAGGG + Intergenic
957187359 3:76959112-76959134 GACTCCTTACAAGTCACCCAAGG + Intronic
960073413 3:113457617-113457639 GACTCCTAAAAAATCCTATGTGG + Intronic
960410420 3:117316647-117316669 GACTACTAAAAAATACCATATGG - Intergenic
960718412 3:120601176-120601198 CACTCCTAAAAACTCACTCATGG + Exonic
962852518 3:139318647-139318669 GCCTCCTAATAAATCACTGAGGG + Intronic
963242352 3:143019658-143019680 CACTCTTCAAAAATCACCTCTGG - Intronic
965752083 3:171985763-171985785 GACTACATAAAAATCACTTAGGG + Intergenic
966046463 3:175557156-175557178 AACTCCTATAAAATATCCTATGG + Intronic
966841737 3:184094941-184094963 AACTCCTAAAAGAACACATAGGG + Intergenic
972026704 4:34388403-34388425 CCTTCCTAAAAAATCACATATGG - Intergenic
972917531 4:43899207-43899229 CACTCCTAAAAACTCACTCATGG + Intergenic
974447803 4:62009078-62009100 CACTACTACGAAATCACCTAAGG + Intronic
974662852 4:64917084-64917106 GACTCCAAGCAAGTCACCTAAGG - Intergenic
977884528 4:102241072-102241094 GACTTCTAAGAAATCATCTCGGG - Intergenic
978691723 4:111520949-111520971 GACTCCTAAAATATTTCCTTAGG - Intergenic
978806165 4:112802834-112802856 GATTCCTAACATATCACCTCGGG - Intergenic
979089916 4:116469564-116469586 GACTCCGAAAAATTCAATTAGGG - Intergenic
980240889 4:130173476-130173498 GGCAGCTAAAAAATTACCTATGG + Intergenic
983041513 4:162933546-162933568 GACTGCTATAAGATCACCAAGGG + Intergenic
983069345 4:163250846-163250868 GACTCCTCAATACACACCTAAGG - Intergenic
984088592 4:175342518-175342540 GACTGTTAAAAGCTCACCTATGG - Intergenic
985948414 5:3204253-3204275 GATTGTTAAAAAATAACCTAGGG - Intergenic
986116024 5:4775622-4775644 CACTCCAAATAAATCACTTAAGG + Intergenic
988632765 5:32948440-32948462 GATTCCTGAAAAGTCACTTAAGG + Intergenic
989737334 5:44724257-44724279 GTCTCCTAAGTAATGACCTATGG + Intergenic
990509618 5:56478666-56478688 GGCTTATAAAAAATAACCTAGGG + Intronic
990941791 5:61209485-61209507 GATTCCTAAAGAATCACTTATGG + Intergenic
995501269 5:112809568-112809590 GAGGACTAAAAAATCACCTTGGG + Intronic
995583067 5:113620819-113620841 GACTTCTAAAAGATCATCTCGGG + Intergenic
995811863 5:116115911-116115933 GACTCCTTAAAATGCACTTATGG + Intronic
996191803 5:120553224-120553246 GACTACTAAAAAATAAATTAAGG + Intronic
997072616 5:130637638-130637660 GACTCCTAAGAGATCATCTCAGG - Intergenic
1004252773 6:14035470-14035492 GACTGAAGAAAAATCACCTATGG + Intergenic
1007413830 6:41680440-41680462 GCCTCCTAAAAACTAACCTCAGG - Intergenic
1007446463 6:41910133-41910155 GACTTCTAAAAATTCTCCAACGG - Intronic
1011374698 6:86676400-86676422 GACTTCTAAAAGATCATCTCAGG + Intergenic
1012649405 6:101734742-101734764 ACCTCCTTAAAAATCACCAATGG - Intronic
1013614206 6:111826523-111826545 GCTTCCTAAAAAATCTCCAAAGG + Intronic
1018968138 6:168504611-168504633 GCTTCCTAAAAGATGACCTAAGG - Intronic
1019907240 7:4074024-4074046 CAACCCTAAAAAAACACCTACGG - Intronic
1023109592 7:36795950-36795972 GTCTACTAAAAACTCAGCTAAGG - Intergenic
1031108502 7:117576124-117576146 GACTACTAAAAAATTATCTTGGG - Intronic
1033921079 7:146392823-146392845 GACTCTTAGAAAATGACCTCAGG + Intronic
1034229940 7:149515848-149515870 GACACATAAAAACTCACATAAGG - Intergenic
1040420395 8:47234497-47234519 GACTCCTAGAATATAACATAGGG + Intergenic
1041923994 8:63216732-63216754 GAATCCTAAAAAATCTTCAATGG - Intergenic
1044114295 8:88315455-88315477 GAGACCCAAAAACTCACCTAAGG + Intronic
1044469274 8:92547437-92547459 GATACCTAAAAAATCTCCTTTGG - Intergenic
1044917214 8:97127960-97127982 CACTCCTAAAAATTCACTCATGG - Intronic
1047429296 8:124776707-124776729 GACTCTTATAAAATCCCCTTGGG - Intergenic
1047678506 8:127229244-127229266 GACTTCCAAAAAAACACCTGTGG + Intergenic
1050622574 9:7469867-7469889 AACTCCTCAAAAATCATCTTTGG - Intergenic
1050966235 9:11806754-11806776 GACTTCTATAAAATCACATAAGG + Intergenic
1053100663 9:35369694-35369716 GACTTCCAAAAGACCACCTAAGG - Intronic
1056218180 9:84425223-84425245 TATTCCTAAGAAATCACCTTGGG + Intergenic
1057608582 9:96520154-96520176 GACTCATCAAAAATCCCCTCGGG + Intronic
1185660544 X:1725332-1725354 GTCCCCAAAAAAATCACCTCTGG - Intergenic
1186425671 X:9463589-9463611 GCCTCTTAAAAACTCACCTCCGG + Intronic
1186970245 X:14834011-14834033 GACAACAAAAAAATCACCTGGGG + Intergenic
1188074284 X:25756056-25756078 GACTGATAAAAAGTCACCTAGGG - Intergenic
1189221681 X:39377610-39377632 GATTCCTAAAAAAGAACCCAGGG - Intergenic
1193103607 X:77643335-77643357 CACTCCCAAAACACCACCTAAGG + Intronic
1195470429 X:105223394-105223416 GACAACTATAAAATCACCAATGG - Intronic
1198994519 X:142559256-142559278 CACTCATAAACAATCACGTAGGG + Intergenic
1199779739 X:151047191-151047213 GACTCCTCCAAAAGCAGCTAGGG - Intergenic
1202246176 Y:22822591-22822613 CATTCCTATGAAATCACCTAGGG + Intergenic
1202399164 Y:24456339-24456361 CATTCCTATGAAATCACCTAGGG + Intergenic
1202471616 Y:25213747-25213769 CATTCCTATGAAATCACCTAGGG - Intergenic