ID: 1155272534

View in Genome Browser
Species Human (GRCh38)
Location 18:24154526-24154548
Sequence ACATCAGCAGCCAATGTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 129}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155272532_1155272534 9 Left 1155272532 18:24154494-24154516 CCCGAATTAGAAATCTTAATTGA 0: 1
1: 0
2: 2
3: 24
4: 334
Right 1155272534 18:24154526-24154548 ACATCAGCAGCCAATGTCAAAGG 0: 1
1: 0
2: 1
3: 24
4: 129
1155272533_1155272534 8 Left 1155272533 18:24154495-24154517 CCGAATTAGAAATCTTAATTGAA 0: 1
1: 0
2: 2
3: 45
4: 492
Right 1155272534 18:24154526-24154548 ACATCAGCAGCCAATGTCAAAGG 0: 1
1: 0
2: 1
3: 24
4: 129
1155272531_1155272534 15 Left 1155272531 18:24154488-24154510 CCATGTCCCGAATTAGAAATCTT 0: 1
1: 0
2: 1
3: 6
4: 89
Right 1155272534 18:24154526-24154548 ACATCAGCAGCCAATGTCAAAGG 0: 1
1: 0
2: 1
3: 24
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155272534 Original CRISPR ACATCAGCAGCCAATGTCAA AGG Intronic
900209986 1:1450671-1450693 GCATCTGCAGGCCATGTCAAAGG + Exonic
901213220 1:7538286-7538308 ACATCAGCAGGCCAGGTCACAGG + Intronic
901758074 1:11453508-11453530 ACACCACCAGCCACTGTCAATGG + Intergenic
903220924 1:21869254-21869276 ACATCAGTAAACAATTTCAATGG + Intronic
904903345 1:33875153-33875175 ACAACAGCCTCCAATGTCATGGG + Intronic
907772195 1:57476554-57476576 ACATTGGCAGCCAATGTGAAGGG + Intronic
910089827 1:83449322-83449344 ACAGCAGCAGCCACTGTTTATGG - Intergenic
910324124 1:85984848-85984870 ACATCAGCAACCCAAGTCAAAGG + Intronic
911924166 1:103806292-103806314 AAATTAGAAGTCAATGTCAATGG + Intergenic
912372555 1:109185210-109185232 ACTTCAGCAGTCAATGACATTGG + Intronic
912470835 1:109905717-109905739 CCAGCAGCAGCCAATGGAAAGGG + Intergenic
912511119 1:110190753-110190775 ACCTCAGCAGCAAAGGTCACAGG + Intronic
916444138 1:164856282-164856304 ACATCAGGTGCAAATCTCAAGGG - Intronic
916499271 1:165373108-165373130 ATAGCAGCAGCTATTGTCAAAGG - Intergenic
916764299 1:167845411-167845433 ACTTCAGCAGCCTAGGCCAATGG - Intronic
917801895 1:178579262-178579284 GCATCAGGAGACACTGTCAATGG + Intergenic
918878378 1:190081546-190081568 ACCTCAGCAGCCAATGGGAAAGG - Intergenic
923795694 1:237153004-237153026 ACACCAGCAGCCATTTTCTAAGG + Intronic
1065339222 10:24687990-24688012 ATATCAGCAACCAATGTTAATGG + Intronic
1074021261 10:109586505-109586527 ACACAAGGAGCCAATGTCAATGG - Intergenic
1083460342 11:62806959-62806981 TCACCAGCAGCCAATGTCAGGGG + Exonic
1083488130 11:62996219-62996241 ACATCAACAGCCAGGGCCAAGGG + Intronic
1085720746 11:78910397-78910419 ACATCACCATCCCATGTCAGTGG - Intronic
1086124581 11:83337121-83337143 ACATCAGTCTTCAATGTCAATGG + Intergenic
1087119621 11:94560013-94560035 AAATAAGCAGCCAATGTTGAGGG + Intronic
1087571986 11:99940181-99940203 TTATCAGCCCCCAATGTCAAGGG + Intronic
1092700336 12:11221935-11221957 ACATCTGCAGCTATTGTAAAAGG - Intergenic
1095370982 12:41466960-41466982 GCAGCAGCAGCCACTGTCAAAGG - Intronic
1097171525 12:57116940-57116962 ACATGAGGGGCCAGTGTCAAAGG + Intronic
1098422296 12:70312798-70312820 GCAACAGCAGCCAATGTATAAGG - Intronic
1101595920 12:106164187-106164209 ACATCAGCACCAAAGATCAAAGG + Intergenic
1101958702 12:109232154-109232176 TCACCAGCAGCAAATCTCAATGG - Intronic
1102804294 12:115765756-115765778 ACATCGGCAGCCACTGTCCTGGG - Intergenic
1103253178 12:119518523-119518545 TCATTAGCAGCCAATCCCAAAGG + Intronic
1112139236 13:96620029-96620051 ACATCACCTGCCAATCTCACAGG - Intronic
1114318658 14:21528342-21528364 ATATCAGCAGCATATTTCAAAGG + Intronic
1118723263 14:68609006-68609028 ACATCAGCAGCCAAGGTCTCAGG - Intronic
1118914133 14:70087366-70087388 ACATCAGCGGCCAATGTTCCAGG - Intronic
1119191883 14:72688515-72688537 ACATCACAAGCCTATGTTAAGGG + Intronic
1120248710 14:82036066-82036088 TCTTCATCAGCCTATGTCAATGG - Intergenic
1121496253 14:94393381-94393403 ACATCAGCAGAGATTGTCAAAGG - Intergenic
1121834474 14:97079633-97079655 TCATCAGCAGCCAAAGGCAGAGG - Intergenic
1125265469 15:37874777-37874799 ATATAAGCAGCCAATATCAAAGG - Intergenic
1126789923 15:52211697-52211719 ATACCAGGGGCCAATGTCAAAGG + Intronic
1127320256 15:57837756-57837778 AAATTTGCAGCAAATGTCAAAGG + Intergenic
1131363215 15:91813738-91813760 ACATCATCACCCAAAGTCCACGG - Intergenic
1131502228 15:92979509-92979531 ACATGAGCAGCCAAAAGCAAAGG - Intronic
1131568737 15:93510002-93510024 ACATAAGCACGTAATGTCAAAGG - Intergenic
1131765663 15:95673135-95673157 ACATCAGAAACCAATATAAATGG - Intergenic
1135038919 16:19102569-19102591 ACATCACCAGACAATGTCAGCGG + Intergenic
1138199737 16:55079832-55079854 ACATCAGTAGACAATGGCTAGGG - Intergenic
1140275460 16:73504782-73504804 ACTCCAGCAGCCAATCTCCACGG - Intergenic
1141075026 16:80998058-80998080 AAATTAGCAGCCAAGGTCAAAGG + Intronic
1149641490 17:58205839-58205861 ATATTTGCAGCCACTGTCAATGG - Exonic
1150478610 17:65492337-65492359 CCATCAGGAGCCATTGTCTAAGG - Intergenic
1150852316 17:68715191-68715213 ACATCAGCAGCAGATGCCAGCGG + Intergenic
1150971347 17:70031732-70031754 AGAGCAGCAGCCAGTGTCCAGGG - Intergenic
1151388419 17:73769727-73769749 ACATCTGGAGCCAATGCCCACGG + Intergenic
1155272534 18:24154526-24154548 ACATCAGCAGCCAATGTCAAAGG + Intronic
1157744495 18:50122848-50122870 ACATCAGCAGTCGATGTCTGAGG - Intronic
1158052685 18:53242180-53242202 ACAGCAGCTGCAAATTTCAAGGG + Intronic
925891962 2:8441488-8441510 AGAGCAGCAGCCAAAGCCAAAGG + Intergenic
926102119 2:10124655-10124677 CCAACAGCAGCAACTGTCAACGG - Intronic
926285882 2:11487842-11487864 ACATCAGAATCCAATGAGAAGGG + Intergenic
926800260 2:16653765-16653787 ACACCAGAAGCGAATCTCAAAGG + Intronic
927051892 2:19338296-19338318 ACCTCAGCTGGGAATGTCAAGGG - Intergenic
928927091 2:36591085-36591107 AGATGAACAGCAAATGTCAAAGG + Intronic
930918050 2:56718567-56718589 ACATCATCAGGCAGTGTCACTGG - Intergenic
931030429 2:58168933-58168955 ACAGCAGCAGCCAAAGTCAGAGG + Intronic
931102199 2:59014985-59015007 ATATAAGCAGCCAAAGTCATAGG - Intergenic
931949374 2:67345250-67345272 ACAACAGCTGCTAATGTTAATGG + Intergenic
932654442 2:73597074-73597096 ACATCAGAAGTCAATATAAATGG - Intronic
934118905 2:88821839-88821861 GCATCAGCAGCCCTTGTCACTGG - Intergenic
935078359 2:99768287-99768309 ACACCTGCAGATAATGTCAATGG + Intronic
936162354 2:110094189-110094211 GCATCAGCAGCCCTTGTCACTGG - Intronic
936182306 2:110277177-110277199 GCATCAGCAGCCCTTGTCACTGG + Intergenic
938785733 2:134627156-134627178 ACATGAGCAGACAATTTCAAAGG - Intronic
941922485 2:170865042-170865064 ACAGCTGCAGCCATTGTCAAAGG - Intergenic
942819215 2:180091400-180091422 ACATCAGCAGCCATATTTAACGG + Intergenic
944268018 2:197749234-197749256 TCATCAGCATCAAATATCAAAGG + Intronic
944590306 2:201210659-201210681 ACATCAGAGGCTAATGTCTATGG + Intronic
948135982 2:235636605-235636627 ACATCAGCATCCCATGACATTGG + Intronic
948967198 2:241392086-241392108 ACTTCACCATCCAATGCCAATGG - Intronic
949071272 2:242026075-242026097 GCATCACCAGCCTATGTGAATGG - Intergenic
1169038844 20:2476221-2476243 ACAACAGGAGCCAAGGTTAATGG + Intronic
1169986364 20:11449624-11449646 ACATCAACATGCAATGTGAAAGG + Intergenic
1171145451 20:22777491-22777513 CCATAAGCAGCCAATGTCAATGG + Intergenic
1174997579 20:55587750-55587772 ACATCAGAACACAAAGTCAAAGG + Intergenic
1180668645 22:17535362-17535384 ACTTCATCAGGCACTGTCAAAGG - Intronic
1181481465 22:23201833-23201855 AAACCTGCAGCCAATGTCCACGG - Intronic
1181632633 22:24159284-24159306 ACGTCAGCAGCCAGTTTCAAGGG - Intronic
1182870422 22:33641377-33641399 CCATCAGCATCCAAGATCAAAGG + Intronic
949151672 3:775754-775776 TGATCAGCAGCCAAAGCCAATGG + Intergenic
956055265 3:65291827-65291849 CCAACAGCATCCAAAGTCAATGG + Intergenic
956179477 3:66503719-66503741 ACAACAACAGCAAATGTCTAAGG + Intergenic
956258585 3:67311585-67311607 ACATCACCAGCCCTTGTCAGTGG - Intergenic
956604275 3:71056504-71056526 ACAGCAGCAGGCACTGCCAAAGG + Intronic
958584361 3:96068367-96068389 ACAGCAGCAGCCAGTGTGCATGG - Intergenic
959812106 3:110631631-110631653 ACATCTGCAGCTTATGTCACAGG + Intergenic
960417288 3:117399985-117400007 ACATCAGCAGTTCATGGCAAAGG - Intergenic
961566495 3:127767315-127767337 ACATAAGCAGTCAGTGGCAAGGG + Intronic
964385000 3:156137897-156137919 ACATCAGCAGTAAAGGTAAAGGG - Intronic
967615737 3:191563923-191563945 ACGTCAGCAGAAAATGTAAACGG + Intergenic
968727144 4:2252980-2253002 ACATGATCAGCCTAGGTCAAGGG + Intronic
969278304 4:6151929-6151951 ACAACAGCAGCTAATGTTCAGGG - Intronic
970108036 4:12607205-12607227 ATATCAGCAGCCCCTGTAAAAGG - Intergenic
972640892 4:40923981-40924003 AAATGAGCAGCCAAGGCCAATGG + Intronic
981056212 4:140364646-140364668 ACATCAGCTGCCAGTCTTAATGG + Intronic
981589825 4:146347776-146347798 ACAGCAGTAGCCAGTGTCATGGG + Intronic
982367858 4:154599772-154599794 ACTTCAGCAGTGATTGTCAAAGG + Intergenic
985535713 5:464807-464829 ACAGCAGCAGCCACTGACACGGG + Intronic
993288217 5:86029935-86029957 ATAGAAGCAGCGAATGTCAATGG + Intergenic
996223919 5:120966375-120966397 TTCTTAGCAGCCAATGTCAATGG - Intergenic
996602019 5:125275308-125275330 AAAGCAACAGCCAATGTCAATGG + Intergenic
996810703 5:127513757-127513779 ACTTCAGCAGGTAATGCCAAGGG - Intergenic
997090668 5:130853237-130853259 ACATAAGGAGCCAATGACACTGG + Intergenic
998971105 5:147593407-147593429 ACATCTGCAATCACTGTCAAAGG + Intronic
1002913420 6:1508856-1508878 ACATCTCCAGCTATTGTCAAAGG - Intergenic
1004854628 6:19736500-19736522 ACCTCAACAGCCATTTTCAAAGG - Intergenic
1005501444 6:26432090-26432112 ACATCAGCATTCAAGTTCAATGG + Intergenic
1005840347 6:29741105-29741127 ACATCTGCAGCCAGTGTTTAGGG - Intergenic
1006417784 6:33914949-33914971 CCATCAGCAGCCACTGTGGAGGG - Intergenic
1007430762 6:41775432-41775454 ACATCGGCGGCCACTCTCAAAGG + Exonic
1007864292 6:44951432-44951454 AAATCAGCAGCTAACATCAAGGG - Intronic
1008225821 6:48915014-48915036 ACATAAGCAGACATTTTCAATGG - Intergenic
1008714177 6:54268199-54268221 ACATTAGGATCCAATGTCATTGG + Intergenic
1008825951 6:55694242-55694264 ACATCAGCACACAATAGCAAGGG - Intergenic
1009291448 6:61888214-61888236 TCATCAGCCACCAATGGCAAAGG - Intronic
1017893601 6:158659844-158659866 ACATCAGCAGCCAGTGAAAAAGG - Intronic
1023424188 7:40017577-40017599 AAATCAGTAGAAAATGTCAAAGG - Intronic
1027306683 7:76905769-76905791 ACAGCAGCAGCCACTGTTTATGG - Intergenic
1029221402 7:98993545-98993567 ACAGCAGCAGCCAAGTTCAGTGG + Intronic
1030559510 7:111066698-111066720 CCATCAGAAGCCAAGGACAAAGG - Intronic
1030974574 7:116105574-116105596 ACATCAGCGGTCAATGCCAACGG - Intronic
1031380917 7:121085106-121085128 ACATCAGCAGCAGATGGCCATGG - Intronic
1033946960 7:146730911-146730933 ACATCAGCTTCCATTTTCAAAGG + Intronic
1035816144 8:2543039-2543061 CCAGGAGCAGACAATGTCAATGG + Intergenic
1036934148 8:12984695-12984717 ACACCAGCAGCCAATGCCTAGGG + Intronic
1040891966 8:52326566-52326588 ACAACAGAAGGCAAAGTCAATGG + Intronic
1044378019 8:91499500-91499522 TCATCAGCATCAAATATCAAAGG - Intergenic
1048702660 8:137110521-137110543 ACCTCACCATCCAATGTCAAGGG - Intergenic
1049112682 8:140657848-140657870 TCATCTGAAGCAAATGTCAAGGG - Intergenic
1051169642 9:14307397-14307419 GCATGAGAAGCGAATGTCAAAGG - Exonic
1056032438 9:82567195-82567217 AGATGTTCAGCCAATGTCAAGGG + Intergenic
1058684522 9:107468438-107468460 ACAACAGCAACCAACATCAAGGG + Intergenic
1058932734 9:109737495-109737517 ACAGCAGCAGCCACTGTAAATGG + Intronic
1185666233 X:1767466-1767488 ATCACAACAGCCAATGTCAAGGG - Intergenic
1187657015 X:21487763-21487785 ACATCAGCAGCCATGGAGAAAGG - Intronic
1188073924 X:25752524-25752546 ACATGAGTAGCTAATGTCAGAGG - Intergenic
1190997304 X:55622615-55622637 ACATATCCAGCAAATGTCAATGG - Intergenic
1194465558 X:94230697-94230719 ACAACAGCAGAAAATGACAATGG - Intergenic
1196613291 X:117738167-117738189 AGAACAGCAGTCAATGTCAAGGG - Intergenic
1198305488 X:135378739-135378761 ACAGCATCAGCCAATTTAAAAGG - Intergenic
1199706381 X:150428897-150428919 ACACCCGGAGCCAATGTAAAGGG - Intronic
1201012057 Y:9557085-9557107 ACATAAGTAGCTAAGGTCAATGG - Intergenic