ID: 1155274420

View in Genome Browser
Species Human (GRCh38)
Location 18:24172325-24172347
Sequence AACTGCTTGATGAAAACTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 325}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155274420 Original CRISPR AACTGCTTGATGAAAACTGA AGG Intronic
900039702 1:448408-448430 AACTACTAGATGAAAACATAGGG + Intergenic
900061134 1:683384-683406 AACTACTAGATGAAAACATAGGG + Intergenic
904909689 1:33925148-33925170 AACTACTGGAAGAAAACTTAGGG - Intronic
907868966 1:58425816-58425838 ATCTGCTTGATTAAATCTAATGG - Intronic
908340390 1:63172471-63172493 AACTGGATGATCAAAACAGAGGG - Intergenic
909551497 1:76902936-76902958 AACTCCTAGAAGAAAACTCAGGG + Intronic
910735823 1:90456278-90456300 AACTCCTAGATGAAAACGCAGGG + Intergenic
912909234 1:113740661-113740683 AACTGCTAGAAGAAAACATAGGG - Intronic
914966098 1:152258890-152258912 AACTGCTAGAAGAAAACACATGG - Intergenic
916608610 1:166367640-166367662 AGCAGATTGATGAAAACTGGAGG - Intergenic
917420821 1:174862041-174862063 AACTCCTAGAAGAAAACTTAAGG - Intronic
917683572 1:177392871-177392893 AAATGCAGGATGAAAACTCAAGG + Intergenic
917991471 1:180384062-180384084 AACTACTAGATGAAAACATAGGG + Intronic
918257619 1:182763945-182763967 AACTGATTAATGAAAGCTGCTGG - Intergenic
920766600 1:208839650-208839672 AACTGCTTGGAGAATACTCAGGG - Intergenic
922470405 1:225873502-225873524 AAGTGAGTGATGAAAACTCAGGG - Intronic
923120580 1:230986400-230986422 AAGTGCTGGAAGAAAAATGAAGG - Intronic
1062935707 10:1385151-1385173 ACCTGCTAGAAGAAAACTCAAGG + Intronic
1063939762 10:11115736-11115758 AAATGCATGATGAAAACATAGGG + Intronic
1067304927 10:45054475-45054497 AACTACTTGAAGAAAACACATGG - Intergenic
1069229460 10:65990861-65990883 AACTGCTTGAAGAAAACATTGGG - Intronic
1070779786 10:79130849-79130871 ACCTGCCTGATGATGACTGATGG - Intronic
1072218880 10:93310763-93310785 AATCTCTTGAGGAAAACTGAAGG - Intronic
1072925485 10:99613168-99613190 AACTGCATGAAGAAACCAGAAGG - Intronic
1074112918 10:110435135-110435157 AAATGCTTGATCAACATTGATGG - Intergenic
1074274258 10:111986473-111986495 AAAAGGTTGATGAAAACAGAGGG - Intergenic
1074466325 10:113684501-113684523 AACTGCTAGAAGAAAACATAGGG - Intronic
1075373664 10:121959323-121959345 AAGTGCTTGATGCTAGCTGAAGG - Exonic
1076913661 10:133406615-133406637 AACTGCTAGAAGAAAACGTAAGG - Intronic
1076925669 10:133483581-133483603 AACTGCTAGAAGAAAACATAGGG - Intergenic
1076965925 11:84321-84343 AACTACTAGATGAAAACATAGGG + Intergenic
1078137895 11:8667243-8667265 AACTCCTAGAAGAAAACAGAGGG + Intronic
1078279292 11:9883793-9883815 AAAAGCTTAATGAAAAATGAGGG - Intronic
1078467020 11:11557987-11558009 AACTGTATGATGGAAACTGAAGG + Intronic
1080597330 11:33785170-33785192 AACTACTTGAAGAAAACATAGGG + Intergenic
1081312879 11:41594417-41594439 AACTTCTTGATGATGATTGAAGG - Intergenic
1084578661 11:70008341-70008363 AACTGCTAGAAGAAAACACAGGG - Intergenic
1084838499 11:71825263-71825285 AATTGCTTGAGAAAATCTGAAGG + Intergenic
1086139302 11:83476891-83476913 AACTGCTTTATAAAGACTAAAGG + Intronic
1086890308 11:92250319-92250341 AACTGGTATATGAACACTGAAGG + Intergenic
1088007308 11:104958175-104958197 AACTACTAGAAGAAAACAGAGGG + Intronic
1088441238 11:109872959-109872981 AACTACTAGAAGAAAACAGAGGG + Intergenic
1088961876 11:114676144-114676166 AACTGCTAGAAGAAAACATAGGG + Intergenic
1090057886 11:123438986-123439008 AAGAGCTTGATGAAACCTGAGGG + Intergenic
1090329185 11:125916952-125916974 AAGTGCTTGAAGAAGAGTGATGG + Intronic
1092546162 12:9453038-9453060 AACTGGTAGAAGAAAACAGAGGG + Intergenic
1093722465 12:22460877-22460899 AGTTGCTTTATGAAAACTGTGGG - Intronic
1094092495 12:26666369-26666391 AAACGCTTGATGAGAACTGGAGG - Intronic
1094188819 12:27675721-27675743 AACTGCTAGATGAAAACATAGGG + Intronic
1094506786 12:31069020-31069042 AACTGGTAGAAGAAAACAGAGGG - Intergenic
1095408902 12:41900607-41900629 AACTACTAGATGAAAACACAGGG + Intergenic
1095624702 12:44301300-44301322 AACTGCTTAATAAAGACAGATGG + Intronic
1098405241 12:70118311-70118333 AAATGCTGGATGAAAAATGAAGG - Intergenic
1098555526 12:71814424-71814446 AACTGTTAGATGAAAGGTGATGG + Intergenic
1098743831 12:74209869-74209891 AACTACTTGAAGAAAACATATGG + Intergenic
1098770931 12:74552115-74552137 AACTTCTGGCTGGAAACTGAAGG - Intergenic
1098996060 12:77121843-77121865 AAGAGCTGGATGAAAACAGAAGG + Intergenic
1099093862 12:78348027-78348049 AACTACTTGAAGAAAACTTTGGG + Intergenic
1099682863 12:85849793-85849815 AACTGCTAGAAGAAAACATAAGG - Intergenic
1100927767 12:99569294-99569316 AACTGCTTCATGAAAAGTGCTGG + Intronic
1101035139 12:100698290-100698312 AACTGCTTAAGGAAAATTGCTGG - Intergenic
1102435987 12:112923953-112923975 AACTACTAGAAGAAAACTTAGGG + Intronic
1103310040 12:119998503-119998525 AAGTGCTGGGTGAAAAGTGAAGG - Exonic
1103313437 12:120031513-120031535 AAGTGATTGATGAATACAGATGG - Intronic
1104105550 12:125655585-125655607 CTCTGCTTGTTGAAAACTCATGG + Exonic
1104403789 12:128500237-128500259 AACTCCTAGAAGAAAACAGATGG + Intronic
1105637027 13:22225509-22225531 CACTGCTTGATAAGGACTGAAGG - Intergenic
1106677084 13:31972080-31972102 AATTCCTTTATGAAAAGTGAAGG - Intergenic
1106817771 13:33428219-33428241 AACTGCTAAATGAAAACATAGGG + Intergenic
1108745166 13:53386049-53386071 CTCTCCTTGATGAAAACTGGAGG - Intergenic
1111006513 13:82257158-82257180 AACTGCATAATGAAAGCTGAGGG + Intergenic
1112147388 13:96715620-96715642 AACTGCTAGAAGAAACCTAAGGG - Intronic
1112873118 13:104000105-104000127 AACTGCTGAAAGAAAACTAAGGG + Intergenic
1113110815 13:106821775-106821797 AAGAGCTTGAGGAAAACTGCAGG - Intergenic
1113141328 13:107154525-107154547 AACAGCTTGTTGAAAACTATGGG - Intergenic
1113203882 13:107894644-107894666 AGCTGCTTGAGGAAGACAGAAGG + Intergenic
1114776330 14:25486459-25486481 AACTGTATGTTGAAAACAGAAGG - Intergenic
1115039517 14:28906572-28906594 AACTTCTAGAAGAAAACTTAGGG - Intergenic
1115733224 14:36294979-36295001 CAATGCTATATGAAAACTGAAGG + Intergenic
1116333598 14:43627821-43627843 AACTACTAGAAGAAAACAGAGGG + Intergenic
1117292626 14:54348308-54348330 AACTCTTTCCTGAAAACTGAAGG + Intergenic
1118287307 14:64487614-64487636 TCCTGCTTGATGGAAACTGGGGG + Exonic
1118515008 14:66517833-66517855 AACTGCTAGAAGAAAACATAGGG + Intronic
1118673163 14:68152805-68152827 AGCTAAATGATGAAAACTGATGG - Intronic
1119547818 14:75485727-75485749 AACTTCATGATGAATTCTGATGG + Intergenic
1119833479 14:77725427-77725449 AACTGCTAGATGAAAACACTGGG - Intronic
1121476912 14:94217200-94217222 GACCGCCTGCTGAAAACTGAGGG + Intronic
1121558067 14:94853575-94853597 AAATGCTTGATGAAAGTTGGTGG + Intergenic
1124146416 15:27130152-27130174 AACTGTTAGATGAAAACCAAGGG - Intronic
1126829163 15:52582156-52582178 AACATCTTGGTGAAAACTGAGGG + Exonic
1126924790 15:53572318-53572340 AACTGCTAGAAGAAAACAGGGGG - Intronic
1126991637 15:54384539-54384561 AACTACTAGAAGAAAACAGAGGG + Intronic
1127193323 15:56556438-56556460 AACTGCTAGAAGAAAACATAGGG - Intergenic
1127593490 15:60452586-60452608 ATCTGCTTAATAAAAACTTATGG + Intronic
1127923458 15:63514053-63514075 AATTGCTTTATAAAAACTGAAGG + Intronic
1129551842 15:76459771-76459793 AACTGCTAGAAGAAAACATAAGG - Intronic
1129762354 15:78137289-78137311 ACCTGCTTGCTGATAAGTGATGG - Intronic
1130792967 15:87175852-87175874 AACTCCTTGAAGAAAACATAGGG + Intergenic
1131686043 15:94768658-94768680 AACTACTTGATTAGAACTAATGG + Intergenic
1131887892 15:96938401-96938423 AACTGCTAAATGAAAACTTTGGG - Intergenic
1132442206 15:101879204-101879226 AACTACTAGATGAAAACATAGGG - Intergenic
1135893958 16:26381586-26381608 AACTTCTTTTTCAAAACTGAAGG + Intergenic
1136908008 16:34120013-34120035 AACTGATTGATGTAATCTGCTGG - Intergenic
1139171977 16:64641643-64641665 AACTAATAGATGAAAACAGAGGG - Intergenic
1140973086 16:80032266-80032288 AACTGCTTGCTGGAAGCTGAAGG + Intergenic
1203143591 16_KI270728v1_random:1784836-1784858 AAATGCTGGATGAAAGATGAAGG - Intergenic
1142786963 17:2231892-2231914 AACTGGTAGAGGAAAACAGAGGG + Intronic
1143862514 17:9901239-9901261 AACTGCTGGAGGAAAACGTAGGG + Intronic
1145220083 17:21081288-21081310 AACTACTAGAAGAAAACAGAGGG + Intergenic
1146310549 17:31765140-31765162 AGCTGCTTGAGGAAAGCGGAAGG - Intergenic
1146731536 17:35196827-35196849 AACTGCTAGAAGAAAACATAGGG - Intergenic
1146956505 17:36939107-36939129 ACCTCCTTGATGAAACCTGGGGG + Intronic
1148401962 17:47371324-47371346 AACTGTTTGATGATAACATAGGG - Intronic
1149232315 17:54549281-54549303 AACTGCTAGAAGAAAACATAAGG - Intergenic
1150033102 17:61762290-61762312 AACTACTAGAAGAAAACAGAGGG + Intronic
1151078741 17:71304373-71304395 AACTACTAGAGGAAAAATGAGGG + Intergenic
1153371557 18:4322537-4322559 AACTGCTAGAAGAAAACATAGGG + Intronic
1153507665 18:5818591-5818613 AACTACTAGATGAAAACATAGGG - Intergenic
1153713047 18:7819430-7819452 CACTGGTTGATGACAACTGTCGG - Intronic
1155075801 18:22353547-22353569 AACTTCTAGAAGAAAACTTAGGG - Intergenic
1155274420 18:24172325-24172347 AACTGCTTGATGAAAACTGAAGG + Intronic
1156159267 18:34340718-34340740 AACTGAAAGAAGAAAACTGAAGG - Intergenic
1158080565 18:53585084-53585106 AATAGCTTTATGAAAACAGAGGG - Intergenic
1159135641 18:64333947-64333969 AAGTCTTTGATTAAAACTGATGG + Intergenic
1159373063 18:67554140-67554162 ATATGATTGTTGAAAACTGAAGG - Intergenic
1159747159 18:72251675-72251697 AACTACTAGAAGAAAACTTACGG + Intergenic
1160425710 18:78777850-78777872 CACTTCTGGATGAAAACTCAGGG + Intergenic
1160642729 19:153951-153973 AACTACTAGATGAAAACATAGGG + Intergenic
1161554080 19:4930663-4930685 AACGGGGTGAGGAAAACTGACGG - Intronic
1162665574 19:12208441-12208463 AACAGATTGACGATAACTGAAGG - Intergenic
1163985570 19:20945443-20945465 TCCTGCTTTTTGAAAACTGAGGG + Intronic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
1165066044 19:33228865-33228887 AGCTGCTAGAAGAAAACTCAGGG + Intergenic
1165264852 19:34652168-34652190 AACTGCTTGAAGAAAACATAGGG + Intronic
1165747175 19:38236665-38236687 AACTGCTTGATGAACCCAGGAGG + Intergenic
1167701757 19:51052255-51052277 ACCTGCTTGATAAAATCTGTGGG + Intergenic
1167914455 19:52728798-52728820 AAATGCTTGATGAAAAAGGTGGG - Exonic
925051465 2:819024-819046 AAATGCTTTAAAAAAACTGAAGG + Intergenic
927352246 2:22129983-22130005 AACTGCTGGAAGAAAACATAGGG + Intergenic
928838766 2:35579925-35579947 AACTCCTTGATGCTATCTGAGGG + Intergenic
930609553 2:53526089-53526111 GACTTCTTAATGAGAACTGAAGG + Intergenic
931010777 2:57910703-57910725 TACTGCTTAATAAAAACTGGTGG + Intronic
931613761 2:64133206-64133228 AAATGATTGAAGAAAACTCATGG - Intronic
933049286 2:77582393-77582415 AACTGCTAGAAGAAAACATAGGG - Intronic
935144283 2:100384235-100384257 AACATCTTGGTGAAAACTGAGGG + Intergenic
935520769 2:104102412-104102434 AACTACTAGAAGAAAACAGAGGG + Intergenic
936391729 2:112080829-112080851 AACTGCTAGAAGAAAACATAGGG - Intronic
936733102 2:115407402-115407424 AACTGCTTCCTGAAGACAGAGGG + Intronic
937346302 2:121127925-121127947 AACTGGTTGCTGAGAACAGAGGG - Intergenic
937878430 2:126845878-126845900 AACTACTAGAAGAAAACTTAGGG + Intergenic
938032465 2:128007120-128007142 AACTGTATGATGAAAACTAGGGG - Intronic
939600485 2:144183445-144183467 AAATGATTGATGAAAACTGTTGG - Intronic
939926057 2:148174347-148174369 AACTCCTAGAAGAAAACTTAGGG + Intronic
940425342 2:153525348-153525370 TACTGCTTGAGAAAAACAGAGGG + Intergenic
941703802 2:168635713-168635735 AACTGCTGGGTGAAAACTTGTGG + Intronic
943973287 2:194439009-194439031 AACTGCTAGAAGAAAACCTAGGG + Intergenic
944640873 2:201724224-201724246 AACTGCTTGTTAAATAATGATGG + Intronic
945098738 2:206243997-206244019 AAGTGCTTGAGGAACACTGCGGG + Intergenic
945343691 2:208687345-208687367 AACTGATTGATGAGAACACATGG - Intronic
945479427 2:210327155-210327177 AACTACTAGAAGAAAACAGAGGG - Intergenic
946688945 2:222296783-222296805 CACTTCTTGATGAACACTTAGGG - Intronic
946725512 2:222657542-222657564 AACTGCTTGATTAATAGTTAGGG - Intergenic
947010419 2:225559942-225559964 GAATGCATGATGTAAACTGAAGG + Intronic
947066337 2:226229807-226229829 AACTGCTAGAAGAAAACATAGGG + Intergenic
1169105640 20:2992027-2992049 AACTGCTTGGTGAAACATGCTGG - Intronic
1169539971 20:6588984-6589006 AAATGCTTAATGAAACCTTAGGG - Intergenic
1169787655 20:9377307-9377329 AAATCCTGGCTGAAAACTGATGG + Intronic
1170044264 20:12068960-12068982 GACTTCTTGATGAAAACAAAGGG + Intergenic
1171575986 20:26318133-26318155 AACTGCTCCATGAAAAGTAACGG - Intergenic
1171576046 20:26319328-26319350 AACTGCTCAATGAAAAGTCATGG - Intergenic
1171576116 20:26320695-26320717 AACTGCTCAATGAAAAGTAATGG - Intergenic
1172880452 20:38196332-38196354 AAAAACTTGATGTAAACTGAGGG + Intergenic
1173459740 20:43233613-43233635 AACTGCTTTCTGGAACCTGAGGG - Intergenic
1174115367 20:48223262-48223284 AACTCCCTGATGACACCTGAGGG - Intergenic
1174759959 20:53197576-53197598 ATATGCTTGATGGCAACTGAAGG - Intronic
1175642804 20:60645097-60645119 TTCTGCCTGATGAAAAATGATGG + Intergenic
1179483071 21:41690819-41690841 AACTGCTAGAAGAAAACATAGGG - Intergenic
1183758513 22:39793591-39793613 AACTACTTGAAGAAAACATAGGG - Intronic
1184178448 22:42803288-42803310 GACTGCCTGATGCAGACTGAGGG + Intronic
1184415287 22:44348659-44348681 AACTGCATCATGAAATCTCAGGG - Intergenic
1184544582 22:45158148-45158170 AACTGCTTAAAGAAACCAGATGG - Intergenic
950915900 3:16644955-16644977 AACTACTTGCTGAAAACTTCAGG + Intronic
950991646 3:17445509-17445531 GACTGCTGTATGGAAACTGAAGG - Intronic
951315418 3:21184316-21184338 AACTCCTTGAAGAAAACACAAGG + Intergenic
951765263 3:26190742-26190764 AACTGCTTTTTGAAAACAGCAGG - Intergenic
952026088 3:29084251-29084273 ACCTTCTTGATGAAAACTCTAGG + Intergenic
952543384 3:34392385-34392407 AACTGCTAGAAGAAAACCTACGG - Intergenic
954589097 3:51764572-51764594 AGCTGCTGGATGGGAACTGATGG - Intergenic
955037894 3:55286567-55286589 AAATGTTTGAGGACAACTGAAGG - Intergenic
955061710 3:55498179-55498201 AACTCCATGATGAACAGTGACGG - Intergenic
957350278 3:79015849-79015871 ATCTGTTTGAAGAAAACTGTTGG + Intronic
957887963 3:86315337-86315359 AGCAGCTTGTTGAAAACTGGAGG + Intergenic
959038658 3:101395245-101395267 AACTGCTGGAAGAAAACATAGGG - Intronic
959315379 3:104799290-104799312 CACTGCTTGATTAAAACTACAGG + Intergenic
963033366 3:141001212-141001234 AAGTGGTTGATGAAACTTGATGG - Intergenic
965136145 3:164771586-164771608 AACTGCTAGAAGAAAACATAAGG - Intergenic
970012146 4:11470881-11470903 AACGGCTTGCTGAAACCTGCTGG + Intergenic
970048228 4:11880567-11880589 AACTGCTAGCTGAAATCTGGAGG + Intergenic
970416182 4:15859250-15859272 AACTACTTGAAGAAAACATAGGG + Intergenic
972838112 4:42899943-42899965 AACTGCTTAATGAATGCTTATGG + Intronic
973174742 4:47191204-47191226 AACTGCAAGAAGAAAACTTAGGG - Intronic
974592565 4:63972740-63972762 CACTGCCTGATGAAAAAAGATGG - Intergenic
975824104 4:78301699-78301721 GACTGCTTAATGAAATCAGATGG - Intronic
976605700 4:86980727-86980749 AACTGATTGAAGAGAACAGATGG + Intronic
977608645 4:99009977-99009999 AACTCCTAGATGAAAACATAAGG - Intronic
978074898 4:104516257-104516279 ATCTGCTCTTTGAAAACTGAAGG + Intergenic
980301052 4:130995376-130995398 AACTGCTTAATGAAAAAAAATGG - Intergenic
980311101 4:131129777-131129799 TACTGCTTGATGTAAAATAAAGG - Intergenic
980771821 4:137383198-137383220 AACTGCTAGAAGAAAACGGAAGG - Intergenic
981098285 4:140804129-140804151 AAGTGCTTCATGAAAACTTCAGG + Intergenic
981733773 4:147927324-147927346 AACTGCTTCATGGATTCTGAAGG + Intronic
983465885 4:168089273-168089295 AACTGCTAGAAGAAAACATAGGG + Intergenic
984443789 4:179807137-179807159 AACAGTTTGAGGAAAATTGATGG - Intergenic
984819331 4:183866477-183866499 AAATGCCTGATTAAAACAGATGG - Intronic
986300444 5:6474510-6474532 AAATGATTGATGAAGAATGAAGG - Intronic
986642988 5:9890141-9890163 AACTTGTTCATGAAAACTGTGGG - Intergenic
986932805 5:12848151-12848173 AACTGCTAGAAGAAAACATAGGG + Intergenic
987530197 5:19108647-19108669 AACTACAAGATGAAAACAGAAGG - Intergenic
988144963 5:27293412-27293434 AATTTCTTGAGGAAAAATGAAGG + Intergenic
988240979 5:28608866-28608888 AACTGCTAGATGAAAACACAAGG + Intergenic
988976961 5:36525269-36525291 ATCTGCTTGAGAAAAAATGATGG - Intergenic
989762690 5:45037630-45037652 AACTTCTTGATTCAAACTTAAGG + Intergenic
989864202 5:46426354-46426376 AACTGCTTAATGAAAACAAAGGG + Intergenic
990410055 5:55533521-55533543 AACTACTGGATTAAAACCGAGGG + Intronic
991238749 5:64431422-64431444 AACTACTAGAAGAAAACTTAGGG + Intergenic
991423357 5:66464478-66464500 AACTGTTAGAGGAAAACAGAGGG + Intergenic
991511417 5:67381014-67381036 AAATTCTTGGGGAAAACTGACGG - Intergenic
992241770 5:74777691-74777713 ATCTTCATGAGGAAAACTGAAGG + Exonic
993898468 5:93568427-93568449 ATTTCCTTGATGAAAACTAATGG + Intergenic
993931067 5:93940561-93940583 AACTGTTTGATGTAAATAGAAGG - Intronic
993990847 5:94656531-94656553 AACTGTTTCAAAAAAACTGAAGG - Intronic
994370939 5:98966845-98966867 AACTCCTAGAAGAAAACTTAGGG + Intergenic
995126850 5:108585957-108585979 AACTGCTAGAAGAAAACATAAGG + Intergenic
996074949 5:119181474-119181496 CACTGAATGATGAAAACTAAAGG + Intronic
996109069 5:119543315-119543337 AACTGAATGATGAAAACACATGG - Intronic
996282315 5:121745575-121745597 AACTGCTTAAAGAAACCAGATGG + Intergenic
996410230 5:123151142-123151164 AGCTGCTTGGCGAAAACTGGAGG + Intronic
999028745 5:148265806-148265828 AACTACTAGAAGAAAACAGAGGG + Intergenic
1000533650 5:162454246-162454268 AACTGCTAGAAGAAAACTTAGGG + Intergenic
1000598292 5:163241693-163241715 AACTGCTAGAAGAAAACATAGGG + Intergenic
1001488931 5:172141862-172141884 AGCTGCTCGATCTAAACTGATGG - Intronic
1002734145 5:181370535-181370557 AACTACTAGATGAAAACATAGGG - Intergenic
1002750396 6:103591-103613 AACTACTAGATGAAAACATAGGG + Intergenic
1003433559 6:6063858-6063880 AACTGATTGATGAGAACACATGG - Intergenic
1003888367 6:10541217-10541239 AGCTGATTGATGAGAACTTATGG - Intronic
1004091832 6:12511065-12511087 AACTGCTGGAAGAAAACATAGGG + Intergenic
1004314780 6:14576296-14576318 AACTGAATGATGAAAACACATGG + Intergenic
1004566670 6:16804449-16804471 AACTTCTTAATGATACCTGAAGG - Intergenic
1004599181 6:17131169-17131191 AACTTATTAATGTAAACTGAAGG - Exonic
1004953435 6:20701081-20701103 AACTGCTTAATGGAACCTGAAGG - Intronic
1005058206 6:21750700-21750722 AAATACTTGATAAAAATTGAAGG - Intergenic
1005873004 6:29990551-29990573 AACTACTAGAAGAAAACTTATGG + Intergenic
1006258771 6:32851821-32851843 AAATGCTAGATGAAAACTCTAGG + Intronic
1006739466 6:36297071-36297093 TACTGCTGGGTGAAATCTGATGG + Intronic
1007014463 6:38449821-38449843 AACTACTAGAAGAAAACAGAGGG + Intronic
1007456863 6:41985255-41985277 AACTACTGGAAGAAAACTTAGGG - Intronic
1007893320 6:45317731-45317753 AGCTGCTAGAAGAAAACAGAGGG + Intronic
1008777216 6:55054826-55054848 AACTGCCTGATGTAAATTCATGG - Intergenic
1008796950 6:55314292-55314314 AACTACTTGAAGAAAACACAGGG - Intergenic
1009260645 6:61482146-61482168 AACTGCTTAATGAAAAAGAAAGG + Intergenic
1010437910 6:75856920-75856942 AACTGCTACAAGAAAACTAATGG - Intronic
1011898831 6:92266450-92266472 AACTTCTTGAAGAAAACACAGGG - Intergenic
1012104762 6:95142823-95142845 ATCTCCTTCATGAGAACTGATGG + Intergenic
1014135815 6:117888333-117888355 AACTACTTTATGAAAGCTTATGG - Intergenic
1015597989 6:134884149-134884171 AACTGCTAGAGGAAAACTTTGGG + Intergenic
1015611136 6:135020715-135020737 AATTGCTGGATGAAAAGGGATGG - Intronic
1015831285 6:137371597-137371619 AACTGTGTGATCAAAACTTAGGG + Intergenic
1016116725 6:140295236-140295258 AACTGCTAGAAGAAAACATAGGG + Intergenic
1017036520 6:150272104-150272126 AGCTGCTTAATGAAACCAGAAGG - Intergenic
1017386814 6:153895232-153895254 AAATGTTTGCTGAAAACTCAAGG + Intergenic
1018086383 6:160304518-160304540 AAAAACTTGATGTAAACTGAAGG - Intergenic
1018377241 6:163224725-163224747 AACTGCTAGAAGAAAACATAGGG + Intronic
1018588537 6:165389871-165389893 AAATACTTGATAAAAATTGAAGG + Intronic
1019238393 6:170642849-170642871 AACTACTAGATGAAAACATAGGG - Intergenic
1020736954 7:11962643-11962665 AAGTGATAGATGAAAACTGAAGG - Intergenic
1021160416 7:17265608-17265630 AACTCCTAGAAGAAAATTGAAGG - Intergenic
1021288219 7:18809232-18809254 AACTACTTGAGGAAAACTTAGGG + Intronic
1021452363 7:20795108-20795130 GAGTTCTAGATGAAAACTGAAGG + Intergenic
1022190898 7:28016082-28016104 AACTGCATGCTGAAAGCTGCCGG + Intronic
1022661239 7:32369035-32369057 AACTACTAGAAGAAAACTTAGGG + Intergenic
1024632946 7:51264158-51264180 AACTGCTGGATCAAAACTGCAGG + Intronic
1024633658 7:51269177-51269199 AACTGCTGGATCAAAACTGCAGG + Intronic
1025500856 7:61294091-61294113 AACTGCTTAATGAAAAGAAAGGG - Intergenic
1025515717 7:61640314-61640336 AACTGCTTAATGAAAAGAAAGGG - Intergenic
1025540053 7:62069140-62069162 AACTGCTTAATGAAAAGAAAGGG - Intergenic
1025574971 7:62625600-62625622 AACTGCTGAATGAAAAACGAAGG + Intergenic
1025597966 7:62955352-62955374 AACTGCTGAATGAAAAATAAAGG - Intergenic
1026002987 7:66577246-66577268 AACTCCTAGAGGAAAACTTAGGG + Intergenic
1027956874 7:84889902-84889924 AGCTGCCTGATGAAAATTAATGG - Intergenic
1029837990 7:103333355-103333377 TACTGCTTTATCAAAACTTAAGG - Intronic
1030731349 7:112993318-112993340 AACTACTAGAAGAAAACTTAGGG + Intergenic
1031534725 7:122919255-122919277 AAATGCTTGAAGAAAAGGGAAGG + Intergenic
1033412925 7:141136413-141136435 AACTACTTGATGAAAACATAGGG + Intronic
1033532325 7:142277244-142277266 AACAGCTTCATCAAAACTGCAGG + Intergenic
1033933148 7:146548956-146548978 AACTCCTAGATGAAAACATATGG - Intronic
1034737228 7:153440446-153440468 CGCTGCTTAATGAAAACTGCAGG + Intergenic
1035416638 7:158694798-158694820 AAAAGCTAGATGAAAAATGAAGG - Intronic
1035509376 8:163758-163780 AACTACTAGATGAAAACATAGGG + Intergenic
1035627762 8:1085456-1085478 AACTACTAGAGGAAAACTTAGGG - Intergenic
1035791625 8:2311493-2311515 ACCTTCTTGAAGAAAACTTAAGG + Intergenic
1035801180 8:2410212-2410234 ACCTTCTTGAAGAAAACTTAAGG - Intergenic
1035876798 8:3198640-3198662 ATCTAATTGCTGAAAACTGAAGG + Intronic
1037954761 8:23046997-23047019 AACTGCTAGAAGAAAACACAGGG + Intronic
1039653845 8:39376554-39376576 AAGCGCTTGCTGAAAAGTGAGGG + Intergenic
1041228704 8:55727943-55727965 AACAGATTGCTGAAAATTGAGGG + Intronic
1041622218 8:59985001-59985023 AACTACTTGAAGAAAACATAGGG - Intergenic
1042382492 8:68133778-68133800 AATTGTTTGATAAAATCTGAGGG - Intronic
1043449325 8:80350524-80350546 AACTTCTAGATTAAAACTGGGGG + Intergenic
1044583141 8:93842531-93842553 AAGTGCTTGATGAAAAGCAAAGG + Intergenic
1045440879 8:102209184-102209206 TACAGCTTGATGGAAACTGTGGG + Intronic
1046267422 8:111848376-111848398 AACTGCTAGAAGAAAACACAGGG - Intergenic
1047481732 8:125289640-125289662 AAATGTTTGATGAATAATGAAGG + Intronic
1052104855 9:24500679-24500701 AACTGCTTATTGAAATCAGAGGG + Intergenic
1052322046 9:27178063-27178085 AACTACTAGAAGAAAACAGACGG - Intronic
1052735466 9:32337986-32338008 AACTAATTGATGAGAACTCATGG + Intergenic
1054363497 9:64204202-64204224 AACTGCTTAATGAAAAAGAAAGG + Intergenic
1055193706 9:73560236-73560258 AACTACTGGATGAAAAGAGAGGG - Intergenic
1055412024 9:76040992-76041014 AAATGCTTTTGGAAAACTGATGG - Intronic
1055588293 9:77781197-77781219 AACTGCTAGAGGAAAACATAGGG - Intronic
1057012835 9:91620937-91620959 TACTGCATGTTGTAAACTGAAGG + Intronic
1060082666 9:120665692-120665714 AACTGCTAGAAGAAAACACAGGG - Intronic
1060622402 9:125079829-125079851 AAATGCTGAATGAAAACTGAGGG - Intronic
1062758597 9:138323141-138323163 AACTACTAGATGAAAACATAGGG - Intergenic
1185525740 X:777415-777437 AACTGCTGGGAGAAAAATGAAGG - Intergenic
1185818231 X:3176587-3176609 AAGTGCTTAATGAACAGTGAAGG + Intergenic
1187043570 X:15623133-15623155 AACTGCTTGATGAAACTGGAAGG - Intergenic
1188265754 X:28071796-28071818 AACTGCTAGAAGAAAACTTTGGG + Intergenic
1188817536 X:34733455-34733477 AACTGCATGATGCTAAGTGAAGG - Intergenic
1189771904 X:44435723-44435745 AGCTGAATGATGAAAACTCATGG + Intergenic
1191197382 X:57739102-57739124 AACTACTAGAAGAAAACAGAGGG - Intergenic
1192354688 X:70389612-70389634 AACTTCTAGAAGAAAACTTAGGG - Intronic
1192689726 X:73349587-73349609 AAGTGCATGGTGAAAACTGTTGG - Intergenic
1193268765 X:79505467-79505489 AACTCCTAGAAGAAAACAGAGGG + Intergenic
1193654190 X:84178820-84178842 AACTTCTAGAAGAAAACTTAAGG + Intronic
1193738171 X:85185561-85185583 CTCTGCTTGAGGAAAAGTGAGGG - Intergenic
1193887260 X:86997567-86997589 AACTGCTTGAAAAAAGCAGAGGG - Intergenic
1193989209 X:88285134-88285156 TTTTGCTTGAGGAAAACTGAAGG + Intergenic
1194733889 X:97488546-97488568 AACTCCTTGAAGAAAACAAAGGG - Intronic
1195484198 X:105384208-105384230 AACTGCTAGAAGAAAACTTTGGG - Intronic
1196113944 X:111977508-111977530 AACTGCTAGAAGAAAACATAGGG + Intronic
1197380827 X:125736752-125736774 TTCTGCTTGAGGAAAACAGAGGG - Intergenic
1197839718 X:130732916-130732938 AACTCCTAGATGAAAACAGGGGG + Intronic
1198748671 X:139917222-139917244 AACTCCTAGAAGAAAACAGAGGG + Intronic
1199052357 X:143251857-143251879 TACTGCTAGATGATAAGTGAAGG + Intergenic
1199112457 X:143951128-143951150 AACTTCTTGAAGAAAACGTAGGG + Intergenic
1199617720 X:149671242-149671264 CACTGCTTGAGGAAAACTCCAGG - Intergenic
1199624923 X:149732007-149732029 CACTGCTTGAGGAAAACTCCAGG + Intergenic
1199745509 X:150769842-150769864 AAGTGCTTGATGACCACAGAAGG + Intronic
1199870730 X:151896021-151896043 ATCTGCTGGATGAAAACTGGAGG - Intergenic
1200839982 Y:7771581-7771603 AACTACTTGAAAAAAAATGAAGG + Intergenic
1200912605 Y:8544360-8544382 AACTACTTGATAACAGCTGAAGG + Intergenic
1201465455 Y:14275506-14275528 AACTCTTTGATGGAAACTGAGGG + Intergenic
1202031276 Y:20576632-20576654 AATTGCTTGAAGAAAACTGTAGG + Intronic