ID: 1155277204

View in Genome Browser
Species Human (GRCh38)
Location 18:24199680-24199702
Sequence GAGAGAAGGACTATTACTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 115}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155277202_1155277204 17 Left 1155277202 18:24199640-24199662 CCTCTTTTGTAAAGAATTTAGTT 0: 1
1: 0
2: 2
3: 31
4: 433
Right 1155277204 18:24199680-24199702 GAGAGAAGGACTATTACTGCAGG 0: 1
1: 0
2: 1
3: 13
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155277204 Original CRISPR GAGAGAAGGACTATTACTGC AGG Intronic
901661213 1:10799038-10799060 GAGTGAAGGACTATTGTTGGAGG - Intergenic
902634655 1:17727174-17727196 CCGAGAGGGACTATTACTGCAGG - Intergenic
907111348 1:51929145-51929167 GAGAGAAGGTCTCTTTTTGCAGG + Intronic
907603196 1:55790402-55790424 GGGAGAAAGGCTGTTACTGCTGG + Intergenic
908470541 1:64439520-64439542 GGGAGAAAGACTAGTTCTGCAGG - Intergenic
909866823 1:80684659-80684681 GAGATATGGACTATTATTTCTGG - Intergenic
910776207 1:90878073-90878095 GAAAGAAGGAACATTTCTGCTGG - Intergenic
912873066 1:113327779-113327801 GTGAGAAGGACTTTTTCTGGTGG - Intergenic
916063746 1:161119787-161119809 GAAAGAAGGAATATCAGTGCTGG - Intronic
916392540 1:164346336-164346358 CAAAGAAGGACTTTCACTGCAGG - Intergenic
917933438 1:179840295-179840317 GAGAGTAGGGCTGTGACTGCCGG + Exonic
918740542 1:188125471-188125493 GTTAGAAAGACTATTAATGCAGG - Intergenic
921240150 1:213171995-213172017 GAGAGAGTAACCATTACTGCGGG - Intronic
921954660 1:220969644-220969666 GAGAGTAGGAAAATTTCTGCAGG - Intergenic
924269132 1:242314508-242314530 GAGAGAAGGAGTTTTCCTGGAGG - Intronic
1066715765 10:38284261-38284283 GAGAGAAGGAGTTTTCCTGGAGG + Intergenic
1069125009 10:64619269-64619291 CAGAGAAGGGCTCCTACTGCTGG - Intergenic
1069673963 10:70233750-70233772 GAGATAAGGAATAGGACTGCGGG - Intronic
1078208066 11:9247318-9247340 GAAAGAAAGGCTTTTACTGCAGG - Intronic
1078713522 11:13817623-13817645 GAGAGAAGGTCAATAACTGGAGG + Intergenic
1078958828 11:16238827-16238849 GTGAGGAGAACAATTACTGCTGG + Intronic
1081259727 11:40944972-40944994 GAGAGCATGACTATTACAGTAGG - Intronic
1081497850 11:43633616-43633638 GAGAGAAGGAGAATGACTGAAGG + Intronic
1082854209 11:57791828-57791850 GAGACAAGGAATATTGCTGCTGG + Intronic
1087028519 11:93678562-93678584 CAGAAAAAGACTTTTACTGCTGG + Intronic
1088509328 11:110558573-110558595 GAGAGGAGGTTTATTATTGCAGG + Intergenic
1092198395 12:6563954-6563976 GAGACAAGGGCTATTAATACAGG + Intronic
1093510918 12:19927272-19927294 CATAGAAGGACAAATACTGCAGG - Intergenic
1096387057 12:51201177-51201199 GAAACATGGACTAGTACTGCAGG - Intronic
1097965348 12:65573240-65573262 GAGATTAGGACTGTTACAGCTGG + Intergenic
1098119814 12:67224202-67224224 GAGAAAAGGAATAGTAATGCAGG + Intergenic
1101014615 12:100487201-100487223 GAGAAAAGCAGTCTTACTGCTGG + Intronic
1102307139 12:111813774-111813796 GAGAGAAGGTCGATTGCTGGGGG + Intergenic
1102582329 12:113897811-113897833 GAGGGAAGGGCTACTACAGCTGG - Intronic
1102727126 12:115075498-115075520 GGGAAAGGGACTATTATTGCGGG - Intergenic
1103995296 12:124825789-124825811 GACAGAAGGACAAATACTGCAGG + Intronic
1107582108 13:41801979-41802001 GAGGGGAGGACAATTACTGGAGG - Intronic
1109414362 13:62017623-62017645 GAGAGAATAACTTTTACTGCAGG - Intergenic
1109551973 13:63915927-63915949 GAAAGAAAGACTCTTACTTCTGG + Intergenic
1110283269 13:73720148-73720170 GAGAGAAAGACCCTTACTCCTGG + Intronic
1113486107 13:110653327-110653349 GAAAAAAGGAATATTACTCCTGG + Intronic
1114615697 14:24067157-24067179 CTGAGAAGGACTAATACTGCAGG - Intronic
1119494038 14:75063586-75063608 GAGTGAAGGGCTATTATTCCAGG + Intronic
1120515090 14:85461201-85461223 GAGAGAAGGACATTGACTTCGGG - Intergenic
1122671858 14:103378867-103378889 GAGAGCTGGAGAATTACTGCAGG + Intergenic
1131045026 15:89307558-89307580 GGGGGAAGCACTTTTACTGCTGG + Intronic
1138154903 16:54693972-54693994 CAGAGAAGATCTATCACTGCTGG + Intergenic
1138880382 16:61007097-61007119 GAGTGAAGGACTAGTTCTGAAGG - Intergenic
1140856524 16:78982632-78982654 GAGGGAAGGACTAATATTTCTGG + Intronic
1144182428 17:12764613-12764635 TATAGAAGGACTATTACTTATGG + Exonic
1147182750 17:38696977-38696999 GAGAGAAGGAGTGTCTCTGCAGG - Intergenic
1148274479 17:46291369-46291391 GTGAGCAGGACTAAAACTGCAGG + Intronic
1150408576 17:64923186-64923208 GTGAGCAGGACTAAAACTGCAGG - Intergenic
1150760211 17:67954589-67954611 GTGAGCAGGACTAAAACTGCAGG - Intronic
1151177475 17:72300712-72300734 GAGAGAAGGTCTTTTACAGTGGG - Intergenic
1153365995 18:4256899-4256921 AGGAGAAGGACCATAACTGCTGG + Intronic
1153610696 18:6881346-6881368 GGGAGACTGACTATAACTGCTGG + Intronic
1155277204 18:24199680-24199702 GAGAGAAGGACTATTACTGCAGG + Intronic
1156204883 18:34874583-34874605 AAGAGAAGGACATTTCCTGCAGG + Intronic
1157015604 18:43708937-43708959 GAGAGAGGGACTATTGCACCAGG - Intergenic
1158745486 18:60195451-60195473 GGGAGGAGGACTCTGACTGCAGG - Intergenic
1162611486 19:11758082-11758104 CAGAGAAGTACAATTACTACAGG + Intergenic
1165984993 19:39760438-39760460 CACAGAAGGACAAATACTGCAGG + Intergenic
1166697814 19:44863906-44863928 GAGAGAAAGTATATTACTGAGGG + Intronic
1168371895 19:55842648-55842670 GAGAGAAGGAAAATTATTGCAGG - Intronic
927143794 2:20147201-20147223 GAGTGAGTGACTATCACTGCTGG + Intergenic
928915912 2:36470208-36470230 AAGAGAAGGACTATTCATGGAGG - Intronic
930279813 2:49356811-49356833 GAGACAGGGACTTTTTCTGCTGG + Intergenic
930511022 2:52345635-52345657 GAGAGAAGGAATGTAACTACAGG + Intergenic
934756562 2:96828408-96828430 GAGAGAAGGACAAACACAGCCGG - Intronic
935179627 2:100677823-100677845 GAGAGAAGTCCTCTTCCTGCTGG + Intergenic
938473599 2:131588678-131588700 GACAGAAGGACAAATACTACGGG + Intergenic
939619292 2:144398832-144398854 GGGAGAAGGAGTATTACTCCTGG + Exonic
943456887 2:188119785-188119807 GAGAGAAGGATTATTAATGCAGG + Intergenic
944272740 2:197802156-197802178 GAAAGAGGGACTGTTAATGCAGG + Intergenic
944535104 2:200701385-200701407 GACAGAAGGATTATCACTGGTGG - Intergenic
945359009 2:208873223-208873245 GAGATAAAGACTCTTAGTGCTGG - Intergenic
946992796 2:225354273-225354295 CAAAGAAGATCTATTACTGCTGG - Intergenic
947037841 2:225879665-225879687 GTGAGAAGGAATATTACAGGAGG + Intergenic
948543779 2:238710668-238710690 AAGAGAATGACTATTATTACTGG - Intergenic
1169975279 20:11318839-11318861 CAAAGAAGGACAAATACTGCAGG + Intergenic
1175917091 20:62431076-62431098 GACAGAAAGACAAATACTGCAGG - Intergenic
1180115815 21:45704268-45704290 GGGAGAAGGGCCATCACTGCTGG + Intronic
1185143809 22:49118558-49118580 GAACAAAGGACAATTACTGCAGG + Intergenic
950464206 3:13143678-13143700 GAGAGAAGGTCCATTTCTGTTGG + Intergenic
957904182 3:86536802-86536824 CAGAGAAAGAAAATTACTGCAGG + Intergenic
959187943 3:103070757-103070779 GAGAGAAGTACCATGACTACCGG - Intergenic
961174183 3:124820492-124820514 GAAAAAAGGACTATAACTGTAGG - Intronic
961717807 3:128870638-128870660 GAGAGAAGGTCTATTTCTGTTGG + Intergenic
972149621 4:36072829-36072851 TAGAGAAGGAATATTACAGTGGG + Intronic
972238413 4:37161272-37161294 CAGAGCAGGACTTTTATTGCTGG - Intergenic
977249860 4:94677529-94677551 AAGAGAAGGACCAGTACTGATGG - Intergenic
980014702 4:127635964-127635986 GAGAGATGAACTATTAATGGGGG - Intronic
983881028 4:172932894-172932916 GAAAGCAGGAATATTACTACAGG - Intronic
984686241 4:182671494-182671516 GAGAAAGGCACTATCACTGCAGG - Intronic
986834718 5:11623084-11623106 GGAGGAAGGACTATTTCTGCTGG - Intronic
987313061 5:16699134-16699156 GGGAGAAGGACTGATACTGGAGG + Intronic
990564130 5:57011986-57012008 GAGAGAAGGACTCATACTCCTGG + Intergenic
993636697 5:90352964-90352986 GAAAGAAGGACATTTATTGCAGG + Intergenic
994569510 5:101497313-101497335 CAGAAAAGGACTATGACTGTGGG + Intergenic
994747521 5:103697221-103697243 GAAAGATGGAGGATTACTGCAGG - Intergenic
997729295 5:136154501-136154523 GAGAGAAGGATGATAACTGTAGG - Intronic
997798142 5:136832138-136832160 GATAAAAGGACTATTACAACAGG - Intergenic
998604988 5:143624167-143624189 AATAGAAGGACTATTTCTGCTGG + Intergenic
999148605 5:149412222-149412244 GTGAGAAGGACTGTTTCGGCAGG - Intergenic
1002788258 6:419954-419976 CACAGAAGGACAAATACTGCAGG - Intergenic
1002906834 6:1456029-1456051 CAGTGAATGATTATTACTGCAGG + Intergenic
1003767144 6:9251115-9251137 GCGGGAAGGACTGTTACTGTAGG + Intergenic
1004885363 6:20046201-20046223 GAGAGAGGGCAGATTACTGCAGG - Intergenic
1007495563 6:42258282-42258304 GAGAGAAGCTCTATTATGGCTGG - Intronic
1007804759 6:44433612-44433634 GGGAGAAGTAGTATTACTTCTGG - Intronic
1008378896 6:50820967-50820989 GAGAGAGGGAATATTACAGGTGG + Intronic
1009858808 6:69298136-69298158 GGGAGAAGGACTATTGCAACAGG + Intronic
1011958074 6:93048936-93048958 GAGAGAAGGAACATGACTGTTGG - Intergenic
1012512307 6:100016296-100016318 AAGAGAAGCACTAATACTGCAGG + Intergenic
1016095042 6:140025969-140025991 GAGAGAAGAAATATTACTACAGG - Intergenic
1021352044 7:19605811-19605833 GGGAGAAGCACTTTCACTGCTGG - Intergenic
1022984232 7:35635025-35635047 GAGTGAAGGAATATGAATGCTGG - Intronic
1023085946 7:36570256-36570278 CACAGAAGGACGAATACTGCCGG - Intronic
1024535102 7:50423908-50423930 GAGGGAAGAACTTTTACTGTGGG + Intergenic
1027940343 7:84670610-84670632 GACAGATGGACTATTAAGGCTGG - Intergenic
1032466022 7:132145725-132145747 GAGTGAAAGACTAGCACTGCAGG + Intronic
1045501204 8:102745616-102745638 GTGAGCAGGAATGTTACTGCAGG + Intergenic
1046825732 8:118689512-118689534 GAGAAAAAGACTATTACTCATGG + Intergenic
1051669703 9:19497036-19497058 AAGAGAAAGACTTTTGCTGCTGG - Intergenic
1188126152 X:26372177-26372199 TAGAGAAGGAGAATTACTGATGG + Intergenic
1189327239 X:40120308-40120330 GAGAGAAGGGGCATTCCTGCAGG - Intronic
1193881572 X:86929310-86929332 TAAAGAAGGACTATTAGTACAGG - Intergenic
1196530726 X:116783076-116783098 GAGAGAAGGTCTAGGACTGAAGG - Intergenic
1196824044 X:119726975-119726997 GAGAGAAGGACTACTCATGCTGG + Intergenic