ID: 1155282194

View in Genome Browser
Species Human (GRCh38)
Location 18:24251017-24251039
Sequence CTGTGCCTGTGGAAAGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1417
Summary {0: 2, 1: 56, 2: 188, 3: 393, 4: 778}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155282184_1155282194 9 Left 1155282184 18:24250985-24251007 CCAGTGGTAGTGGTGCTCACAGG 0: 1
1: 1
2: 7
3: 46
4: 273
Right 1155282194 18:24251017-24251039 CTGTGCCTGTGGAAAGGGGAGGG 0: 2
1: 56
2: 188
3: 393
4: 778
1155282179_1155282194 19 Left 1155282179 18:24250975-24250997 CCCCCATGGGCCAGTGGTAGTGG 0: 1
1: 1
2: 7
3: 39
4: 192
Right 1155282194 18:24251017-24251039 CTGTGCCTGTGGAAAGGGGAGGG 0: 2
1: 56
2: 188
3: 393
4: 778
1155282183_1155282194 16 Left 1155282183 18:24250978-24251000 CCATGGGCCAGTGGTAGTGGTGC 0: 1
1: 0
2: 16
3: 50
4: 259
Right 1155282194 18:24251017-24251039 CTGTGCCTGTGGAAAGGGGAGGG 0: 2
1: 56
2: 188
3: 393
4: 778
1155282182_1155282194 17 Left 1155282182 18:24250977-24250999 CCCATGGGCCAGTGGTAGTGGTG 0: 1
1: 15
2: 36
3: 102
4: 305
Right 1155282194 18:24251017-24251039 CTGTGCCTGTGGAAAGGGGAGGG 0: 2
1: 56
2: 188
3: 393
4: 778
1155282181_1155282194 18 Left 1155282181 18:24250976-24250998 CCCCATGGGCCAGTGGTAGTGGT 0: 1
1: 7
2: 31
3: 96
4: 289
Right 1155282194 18:24251017-24251039 CTGTGCCTGTGGAAAGGGGAGGG 0: 2
1: 56
2: 188
3: 393
4: 778

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155282194 Original CRISPR CTGTGCCTGTGGAAAGGGGA GGG Intronic
900991927 1:6102033-6102055 CTGTGCCTGGGGAAAGGGGTCGG + Exonic
901029785 1:6300457-6300479 CCGTGTTTGTGGAGAGGGGAGGG - Intronic
901029844 1:6300696-6300718 CCGTGTTTGTGGAGAGGGGAGGG - Intronic
901029859 1:6300759-6300781 CCGTGTTTGTGGAGAGGGGAGGG - Intronic
901088245 1:6625152-6625174 CGGGGCCTGCGGAGAGGGGAGGG - Exonic
901810644 1:11765310-11765332 CTGTGCCTGTGGAGTGGGCTTGG + Intronic
901940253 1:12656384-12656406 CTGGGGCTTTGGAAATGGGAAGG + Intronic
902471405 1:16649291-16649313 GCTTGCCTGGGGAAAGGGGAAGG - Intergenic
902644989 1:17791711-17791733 ATTTGCCTGTGGAACGAGGAGGG + Intronic
903193499 1:21669211-21669233 CTGCGGCCCTGGAAAGGGGAAGG - Intronic
903220116 1:21864802-21864824 CTGTGCCTGTGCAGAGGTGGTGG + Intronic
903287752 1:22287324-22287346 TGGGGCCTGTGGCAAGGGGAAGG - Intergenic
903545044 1:24118706-24118728 CTGTGTCCCAGGAAAGGGGAGGG + Intergenic
903649071 1:24912079-24912101 CAGTGCCTGAGGAAAGAAGATGG + Intronic
903764629 1:25726226-25726248 CTGCACCTGGGGAAAGGGAAAGG + Intronic
904285997 1:29453640-29453662 CTCTGCCCCTGGAGAGGGGAGGG + Intergenic
904700326 1:32354081-32354103 CTGTTCCTGTGGAATGGTGGGGG - Intronic
904700989 1:32357960-32357982 CTGGGCCTGAGGAATGGGGAGGG - Intronic
905174045 1:36125263-36125285 CCGTGGCTGTGGAAAGAGGAGGG - Intergenic
905545147 1:38791857-38791879 CTGTGCTTGTGGAAAGGATGGGG + Intergenic
905794637 1:40808648-40808670 CTGTCCCTGTGGAAGCTGGAGGG + Intronic
906319666 1:44808288-44808310 GTGTGCCTGTGGAGGAGGGAAGG + Intergenic
906352923 1:45079366-45079388 CTCTGCCTTTGGAAAGGGGCAGG - Intronic
906724905 1:48037108-48037130 GTGTGTATGTGGAAAGGGGAGGG - Intergenic
906734843 1:48115571-48115593 GTCTGCCTGTAGAAAGGGGAGGG + Intergenic
906827003 1:48992718-48992740 CTCTGCTTATGGAAAGGGGAGGG - Intronic
907004196 1:50893928-50893950 CTCTTCCTATGGAAAGGGGAGGG - Intronic
907012735 1:50978232-50978254 CTGTGCCTGAGGACCGGGGCCGG + Intergenic
907023822 1:51095288-51095310 CTTCGCTTGTGGAAAGGGGAGGG + Intergenic
907404963 1:54248321-54248343 CAGGGCCTGCGGGAAGGGGAAGG + Intronic
908175519 1:61552086-61552108 CTCTGCTTCAGGAAAGGGGAGGG - Intergenic
908206137 1:61851785-61851807 CTGTGGCAGTGGAAATGGAAAGG + Intronic
908302239 1:62773779-62773801 CTCTGCCTGAAGAAAAGGGAGGG - Intergenic
908562474 1:65320525-65320547 CTGTGCCTATGAAAAAGGCAGGG - Intronic
908598935 1:65718540-65718562 CTCTGTCTTTGGAAAGGGGAGGG - Intergenic
909128636 1:71707408-71707430 CTCTGCCTTTGGAAAGGGGAGGG + Intronic
909270427 1:73617226-73617248 GTCTGCCTTTGGAAAGTGGAGGG - Intergenic
909271360 1:73627405-73627427 CTCTGCTTGTGAAAAGTGGAAGG + Intergenic
909316311 1:74223775-74223797 CTCTGCCTATGGAAAGGGGAGGG + Intronic
909420698 1:75461832-75461854 CTCTGCCTTTGGAAAGGGGAGGG + Intronic
909848756 1:80433814-80433836 TTATGCCTATGGAAAGAGGAGGG - Intergenic
910231816 1:84996006-84996028 GTGTGCCTGTGGAAAGTTCACGG + Intronic
910289833 1:85589087-85589109 CTCTTCCTCTGAAAAGGGGATGG + Intergenic
910349239 1:86277263-86277285 CTCTGCCTGTGGAAAGGGGAGGG - Intergenic
910515327 1:88054152-88054174 CTCTGCCTGTGGAAAAGAAAGGG - Intergenic
910547406 1:88433430-88433452 CAGTGTCTTTGGAAAGGGAAGGG + Intergenic
910716338 1:90235696-90235718 CTATGTCTGTGGAAAGTGGAGGG - Intergenic
910894370 1:92052428-92052450 CTTTGGCTTTGGAAAGGGGATGG - Intronic
911019912 1:93375700-93375722 CTCTGCTTGTAGAAAGAGGAGGG + Intergenic
911064229 1:93773434-93773456 CTGTGCAGGTGGGAAGGGGAGGG + Intronic
911068341 1:93812259-93812281 AAGGGCCTGGGGAAAGGGGATGG - Intronic
911241321 1:95470748-95470770 TTTTGCCTGTGTAAAGGGGAGGG - Intergenic
911373721 1:97024896-97024918 CTCTGCCTTTGGAAAGGGGAAGG + Intergenic
911536472 1:99106195-99106217 CTTTGCCTTTGGAAAGGGGAGGG + Intergenic
911887804 1:103326408-103326430 ATCTGCCTTTGGAAAGGGGAAGG - Intergenic
911967856 1:104390172-104390194 CTCTGCCTTTGGAAAGGAGAGGG + Intergenic
912015397 1:105027762-105027784 TTCTGCTTGTGGAAAAGGGAGGG + Intergenic
912059053 1:105641645-105641667 CTCTGCCTTTGAAAATGGGAAGG + Intergenic
912152812 1:106880488-106880510 CTCTGCCTGTGGAAAGAGGAGGG + Intergenic
912242711 1:107927688-107927710 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
912601180 1:110934602-110934624 CTCCGCCTTTGGAAAGGGGAAGG + Intergenic
912756615 1:112329623-112329645 CGGTGGCTGAGGATAGGGGAGGG + Intergenic
912800273 1:112715545-112715567 CTGTTGCTGTGGGAAGGGGGCGG + Intergenic
913044875 1:115065379-115065401 CTGCTCCTGTGGGAAGGAGAAGG - Intronic
913450761 1:118991030-118991052 GTGTGTCTGTGGAATGGGGGTGG - Intergenic
914195292 1:145445358-145445380 CTCTGCCTGTGGGTGGGGGATGG - Intergenic
914944440 1:152051539-152051561 CTGTGCCTGTGGCAGGGGAGGGG + Intergenic
915288016 1:154865073-154865095 CACAGCCTGGGGAAAGGGGAGGG + Intronic
915693579 1:157716071-157716093 CTCTGCCTATGGAAAGGGCAGGG - Intergenic
915752895 1:158228468-158228490 CTGTGCTTGAGGAAAGGGGAGGG + Intergenic
915810933 1:158909865-158909887 CTCTGCTTGTGGAAACAGGAGGG + Intergenic
916369404 1:164073621-164073643 CTCTGCCTTTGAAAAGGGGAGGG - Intergenic
916729609 1:167554057-167554079 GTGTGCCTGTGTAAAGAGGCTGG - Intergenic
916895374 1:169156967-169156989 ATGTGCATGTGGAAAGCGAATGG - Intronic
917208158 1:172600083-172600105 CTGTGCCTGTAGCAACTGGATGG - Exonic
917246264 1:173004666-173004688 CTCTGCCTGTGGAACAGGGAAGG - Intergenic
917364076 1:174209506-174209528 CTCTGCCTGTGGAAACGACAGGG + Intronic
917387215 1:174490804-174490826 CTCTGCTTGTGGAAAGAGGAGGG - Intronic
917958663 1:180125595-180125617 GCGTGGCTGTGGAAAGAGGATGG - Intergenic
917986566 1:180326254-180326276 CTCTGCCTGTGGAAAAGGGAGGG - Intronic
918358056 1:183724575-183724597 CTCTGCTTGTGGAAGGGGGAGGG + Intronic
918416177 1:184310868-184310890 CTCTGCTTTTGGTAAGGGGAGGG - Intergenic
918476189 1:184927891-184927913 TTCTGCTTGTGGAAAGGAGAGGG - Intronic
918666170 1:187154223-187154245 CTGTGCCTTTGGAAAGGGGAGGG - Intergenic
919008526 1:191929615-191929637 TTCTGCCTTTGGAAAGGGGAGGG + Intergenic
919023527 1:192138975-192138997 ATGCGCCTGTGGAGATGGGAGGG + Intergenic
919373553 1:196763292-196763314 CTCTGACTTTGGAAAGGGGAGGG - Intergenic
919379993 1:196847969-196847991 CTCTGACTTTGGAAAGGGGAGGG - Intronic
919502160 1:198350592-198350614 GTGTGCCAGTAGACAGGGGAGGG - Intergenic
919822776 1:201483492-201483514 CTGTGTCTGTGGAGCTGGGAGGG - Intergenic
919841180 1:201610587-201610609 CTGTGCCTGCGGACAGAGGCAGG - Intergenic
919983832 1:202659181-202659203 CTGTGCATTGGGAAAGGGGAGGG - Intronic
920216923 1:204367514-204367536 CTGTACCGGTGGGAAGGAGATGG - Intronic
920531554 1:206706282-206706304 CTGTGGCTGTGGCCAGGGAAAGG - Intronic
920744970 1:208617562-208617584 CTTTGCCCTTAGAAAGGGGAGGG + Intergenic
920953597 1:210597566-210597588 CTCTGCTTGTGGAAAGGAGAAGG - Intronic
921296102 1:213705356-213705378 CTCTGCCTTTGGAAAGGGGATGG - Intergenic
921593478 1:217029954-217029976 CTGTCCCTGTGCTAAAGGGAGGG - Intronic
921743253 1:218709951-218709973 TTGTGACTGTGAAGAGGGGAAGG + Intergenic
922377199 1:224980390-224980412 CTCTGCCTGTGGAGAGAGGAAGG + Intronic
922388493 1:225113715-225113737 CTCTGCCTGTGGAAAGGGAAGGG - Intronic
922698684 1:227745310-227745332 CTGCACCTGGGGAGAGGGGAAGG - Intronic
923284047 1:232474073-232474095 CTGTGAATGGGGAAAAGGGATGG + Intronic
923639553 1:235740425-235740447 TTGTCTCTGTGGAAGGGGGACGG - Intronic
923886561 1:238164305-238164327 CTCTGCCTTTTGAAAGGGGAGGG - Intergenic
924648960 1:245905488-245905510 CTGTGCCTTTGGAAAAAGGAGGG + Intronic
924833816 1:247628315-247628337 CTCTGCCTGTGGAAAATGGGGGG - Intergenic
1063593590 10:7412988-7413010 CGGGGCCTGTGGAAAGGGAGGGG + Intergenic
1064696740 10:17974998-17975020 CTCTGCCTTTGTAAAGGGAAGGG - Intronic
1065381472 10:25095755-25095777 TTCTTCCTTTGGAAAGGGGAGGG - Intergenic
1065431396 10:25660998-25661020 CTCTGTCTGGGGAAAGGGGAGGG - Intergenic
1065921901 10:30400052-30400074 CTCTGCCTGTGAAAAGGCAAAGG + Intergenic
1066421886 10:35271455-35271477 CTGTGCTTCTGGCAGGGGGAAGG + Intronic
1066708291 10:38204256-38204278 CTCTGCCTGGGGAAAGGGGAGGG + Intergenic
1066981218 10:42418326-42418348 CTCTGCCTGGGGAAAGGGGAGGG - Intergenic
1067829969 10:49605940-49605962 CTGAGCCGGTGCACAGGGGATGG + Intergenic
1068411325 10:56659951-56659973 CTCTGCCTTTGGAAAGGGGAGGG - Intergenic
1068877017 10:62007910-62007932 CTGGGCTTGTGGAAGAGGGATGG - Intronic
1069248862 10:66244159-66244181 CTCTGCCTATGGAAAGAGGTAGG + Intronic
1069343550 10:67440248-67440270 CTCCGCCTGTGGAAAGTGGAGGG + Intronic
1069395022 10:67978379-67978401 CTCTGCCTTTGCAAAGGGGAGGG + Intronic
1069933516 10:71899805-71899827 CTCTGCCTTTAGAAAGGGGAGGG - Intergenic
1070059328 10:72967313-72967335 CTCTGCTTGCAGAAAGGGGAGGG - Intergenic
1070117378 10:73541964-73541986 CTGAGCCTAAGAAAAGGGGAGGG + Intronic
1070464290 10:76703934-76703956 CTTTGCTTGCAGAAAGGGGAGGG + Intergenic
1070468419 10:76749757-76749779 CTGTGTCTCTGACAAGGGGAAGG + Intergenic
1070722207 10:78764611-78764633 CTGTGCCTATGCAAAGGAGTGGG + Intergenic
1070829402 10:79409456-79409478 CTGTCCCTGAGGAGAGGGCAGGG - Intronic
1071018115 10:81021634-81021656 CTTTGCCTTTGAAAAGGGGAAGG + Intergenic
1071197174 10:83175227-83175249 CTGTGCCTTTGAAAAGGGTAGGG - Intergenic
1071201333 10:83222799-83222821 CTGTGAATGTAGAAAGGGAAAGG + Intergenic
1071215222 10:83393384-83393406 TTCTGCCTTTGGAAAGGAGAAGG - Intergenic
1071299762 10:84247757-84247779 CAGAGCCTGTGGACTGGGGAGGG - Intronic
1071418539 10:85464324-85464346 CTCTGCATTTGGAAAGGAGAAGG + Intergenic
1071475706 10:86023447-86023469 CTGAGCCAGTGGAGACGGGATGG - Intronic
1071482129 10:86072719-86072741 CTGAGACCGTGGAAAGGGGTGGG - Intronic
1071963044 10:90824781-90824803 CTCTTCTTGTGGAAGGGGGAGGG + Intronic
1072052010 10:91714298-91714320 CTGTGCCTGGGGGAAGTGGGAGG + Intergenic
1072058841 10:91788434-91788456 CTGTGCCTGGGGAAAGGAGAGGG + Intergenic
1072083660 10:92057358-92057380 CTCTGCCTTTGGAAAGGGGAGGG + Intronic
1072733105 10:97861416-97861438 CTTTGCCTGAGGCAAGGAGAAGG - Intronic
1073193728 10:101670854-101670876 CTGGGCTTGTGGGGAGGGGAAGG + Intronic
1073267088 10:102234334-102234356 CTCTGCCTGTGGAAAGAGCAGGG - Intronic
1073823339 10:107291158-107291180 CTCTGCCTTCGGAAAGGGGAGGG - Intergenic
1073966972 10:109001414-109001436 TGGTGCCTGTGGAATGGGGAGGG - Intergenic
1074408529 10:113202058-113202080 TTCTGCCTGTGGAAATGGGAGGG + Intergenic
1074638054 10:115344366-115344388 TTCTGCCTTTGGAAAAGGGAGGG - Intronic
1074969007 10:118520337-118520359 AGGTGCCTGGGGAAAGAGGAGGG + Intergenic
1075135929 10:119786307-119786329 CTGGGCCTCTGGAAAAGGGAAGG + Intronic
1076566121 10:131400659-131400681 CTGTGGCAGTGCAAAGGGGAGGG + Intergenic
1076590064 10:131576839-131576861 CTGTGCCACTGCAATGGGGATGG - Intergenic
1077002345 11:330574-330596 GTGTGCCTGTGAAGAGGGCAGGG - Intergenic
1077108718 11:852922-852944 CTGGGCCTGTGGGGAGGGCATGG + Intronic
1077239491 11:1503121-1503143 CAGAGCCTGTGGAGAAGGGATGG + Intergenic
1077380558 11:2235050-2235072 CGTTGCCTGAGGAAAGGGTAAGG + Intergenic
1077427487 11:2490180-2490202 CTTTGCCTATGGAAAGGAGAAGG + Intronic
1077439500 11:2561472-2561494 CTGGGCCTGTGGAAAGGGCATGG - Intronic
1077740469 11:4840085-4840107 CTTTGCCTTTGAAAAGTGGAGGG + Intronic
1077997633 11:7467713-7467735 CTGTGCCTTTCTATAGGGGATGG - Exonic
1078023322 11:7672966-7672988 CTGTGCCTTTGGTGTGGGGAGGG - Intronic
1079037986 11:17037196-17037218 CTCTGCCTTTGGAAAGGGGAGGG + Intergenic
1079083621 11:17430367-17430389 CAGGGGCTGTGGAAAGGGTAGGG + Intronic
1079183562 11:18215411-18215433 CTTTGCCTTTAAAAAGGGGAGGG + Intronic
1079311787 11:19373047-19373069 CTGTGTCTGTGGGAATGGTATGG - Intronic
1079517022 11:21281314-21281336 CTCTGCCTGTGGAAACGGGAGGG + Intronic
1079532951 11:21477201-21477223 CTTTGCTTGAGGAAAGGAGAGGG + Intronic
1079571787 11:21952534-21952556 CTCTGCCTGAGGAAAGAAGAAGG + Intergenic
1079571923 11:21953432-21953454 CTCTGCCTTTGGAAAGGGGAAGG + Intergenic
1079625950 11:22618020-22618042 CTCTGCCCTTAGAAAGGGGAGGG - Intergenic
1079686927 11:23370727-23370749 ATCTGTCTGTGGAAAGGGAAGGG + Intergenic
1079729261 11:23920394-23920416 GTCTGCCTTTGGAAAGGGGAAGG - Intergenic
1079849259 11:25510552-25510574 CTGTGTCTGTGGGAAGGTGGGGG - Intergenic
1080061803 11:27964365-27964387 CAGGGCATGTGGAGAGGGGAAGG - Intergenic
1080636837 11:34131552-34131574 CTGGCCCTGTGAAAAGGAGAGGG + Intronic
1081049219 11:38316280-38316302 CTCTGCTTGAGGAAAGGGGAGGG + Intergenic
1081745291 11:45468581-45468603 CTGGGTCTGTGAAAAGGAGAAGG - Intergenic
1081892457 11:46555115-46555137 ATGTGTGTGTGGAAATGGGATGG - Intronic
1082251940 11:49992236-49992258 CTCTACCTTTGGAAATGGGAGGG + Intergenic
1082556398 11:54567711-54567733 CTCTACCTTTGGAAATGGGAAGG - Intergenic
1083269528 11:61564816-61564838 CTGGGCCAGTGGATGGGGGAAGG - Intronic
1083478428 11:62928414-62928436 CTATCTCTGTGGAAAGGGGGCGG - Intergenic
1083528768 11:63397616-63397638 CTCTGCTTGTGGAAAAGGGTGGG - Intronic
1083935623 11:65868422-65868444 CTGTGCCAGGGGAGAGGGGCTGG + Intronic
1084056429 11:66636928-66636950 CTGAGCCTGTGTAAAGGCCACGG - Intronic
1084430201 11:69106717-69106739 CTGAGCCCGTGGGCAGGGGACGG + Intergenic
1084485255 11:69444275-69444297 CTATACCTGTGGGGAGGGGAGGG + Intergenic
1085122158 11:73974162-73974184 CTGTGGCTGTGGAGGGTGGAAGG + Intergenic
1085147376 11:74213242-74213264 CTATGCTTGTGGAAAGGATAGGG + Intronic
1085194674 11:74661921-74661943 CTCGGCCTGTGGAAAGGGAAGGG - Intronic
1085223516 11:74896430-74896452 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
1085253620 11:75159736-75159758 CTGTGCCTCTGGGCAGGGGAGGG - Intronic
1085392962 11:76191851-76191873 CAGAGCCTGCGGACAGGGGAAGG + Exonic
1085707440 11:78799291-78799313 TTGGGGCTGGGGAAAGGGGATGG + Intronic
1085845155 11:80056603-80056625 ATGTGCTTGTGGGAAGTGGATGG - Intergenic
1086007057 11:82049123-82049145 CTCTGCCTTTGGAAAGAGGAAGG + Intergenic
1086033147 11:82384243-82384265 CTCTGCCTGTGGAAAGAAGAAGG + Intergenic
1086468132 11:87076269-87076291 CTCTGCCTGTGGAAAGGGGAGGG - Intronic
1086479548 11:87219440-87219462 CTGTGCATGTGGTCAGGGGGTGG + Intronic
1087178583 11:95119902-95119924 CTCTGCCTTTGGAAAGGGGAGGG - Intronic
1087313323 11:96576881-96576903 CTCTGCCTGGGGAAAGGGGAGGG - Intergenic
1087492317 11:98844527-98844549 CTCTGCCTGTGGAAAGGTGAGGG - Intergenic
1087522542 11:99259685-99259707 ATGTGCCTGTGGAAATTGAAAGG + Intronic
1087598336 11:100282821-100282843 CTCTGCCTTTGGAAAGGAGAGGG - Intronic
1087877000 11:103370225-103370247 CTCTGCCTTTGGAAAGGGGAAGG + Intronic
1087887634 11:103498218-103498240 CTCTGCTTGTGGAAAGGTGAGGG + Intergenic
1088009873 11:104986728-104986750 CTCTGCCTGTGGGAAGGGAAGGG + Intergenic
1088154789 11:106790227-106790249 CTCTGCCTGTGGAAAGGGGAGGG - Intronic
1088510885 11:110573604-110573626 CAGTGTCTTTGGACAGGGGAAGG + Intergenic
1088569980 11:111213490-111213512 CTCTGTCTTTGGAAAGGAGAGGG + Intergenic
1089172881 11:116527646-116527668 CTGTGCCTGGGAACATGGGAAGG - Intergenic
1089578809 11:119468697-119468719 CTGTACTTGAGGAAAGGGGAGGG - Intergenic
1089762149 11:120735768-120735790 CTCTGCCTGTGGAAAGGAGAGGG - Intronic
1089824648 11:121264423-121264445 CTCTGCCTTTGGAAAGGAGAGGG - Intergenic
1089937141 11:122375877-122375899 CTCTGCCTTTGGAAAGAAGAAGG + Intergenic
1089946581 11:122480078-122480100 CTCTGCCTATGGAAAGGGGAGGG + Intergenic
1090210315 11:124916460-124916482 CTCTGCTTGAGGAAAGGAGAGGG - Intergenic
1090461638 11:126896438-126896460 CTGTAGCTCTGGAAAGGGCATGG - Intronic
1090515620 11:127423592-127423614 CTCTGCATATGGAAAGGGGAGGG - Intergenic
1091668113 12:2433766-2433788 ATGTGGCTCTGGAAAGGAGAAGG - Intronic
1091668931 12:2438624-2438646 ATGTGGCTGGGGAACGGGGAGGG + Intronic
1091711730 12:2745823-2745845 CAGTGGCTGTGGGAAGGGAAGGG - Intergenic
1092276789 12:7067532-7067554 GTGTGCCTGTGGATATGGGGTGG + Intronic
1093025267 12:14239994-14240016 CTGTGGCTGTGGGAAGAGAATGG + Intergenic
1093419980 12:18964345-18964367 TTCTGCCTGGAGAAAGGGGAAGG - Intergenic
1093538250 12:20248326-20248348 CTCTGTCTGTGAAAAGGGAAGGG + Intergenic
1093903247 12:24660839-24660861 CTCTGCCTGTGGAAAGGAGAGGG - Intergenic
1093914651 12:24788014-24788036 TAGTGCCTGTGAAAAGAGGAGGG - Intergenic
1093991169 12:25591415-25591437 CTCTGCCTTTGGAAAGGGGATGG + Intronic
1094258625 12:28465119-28465141 CTCTACCTTTGGAAAGGGGAGGG + Intronic
1094380703 12:29840366-29840388 CTCTGCCTGTGGAAAGGGGAGGG - Intergenic
1094655844 12:32418950-32418972 TTCTGCCCGTGGAAAGGGGAGGG - Intronic
1094658136 12:32440883-32440905 TTCTGCCTTTGGAAAAGGGAGGG - Intronic
1094707378 12:32927361-32927383 CTTTGCCGGTGGGAAGGGGTGGG + Intergenic
1095099471 12:38165676-38165698 CTCTGCCTTTGGAAAAGGAAAGG - Intergenic
1095101085 12:38184436-38184458 CTCTGCCTGCAGACAGGGGAAGG + Intergenic
1095133698 12:38572356-38572378 CTCTGCCTTTGGAAATGGGATGG + Intergenic
1095227588 12:39695509-39695531 ATCTGCCTTTGGAAAGGGAAGGG + Intronic
1095639831 12:44475349-44475371 CTCAGCCTTTGGAAAGGGGAGGG - Intergenic
1095770468 12:45949695-45949717 CTGGGGCTGGGGAAAGGGGTAGG + Intronic
1095860308 12:46908814-46908836 CTCTGCCTGGGGTAAGGGTAGGG + Intergenic
1096026482 12:48368639-48368661 CTGTTCCTGGGAAAAGGAGAAGG + Intergenic
1096343892 12:50828499-50828521 CGTTGCCTGTGGAAAATGGAGGG - Intergenic
1097150842 12:56978854-56978876 CTCTGCCTTTGGAAAAGGAAGGG - Intergenic
1097473186 12:60021378-60021400 CTCTACCTTTGGAAAGAGGAAGG - Intergenic
1097508686 12:60507986-60508008 CTCTGCCTGTAGAAAAGGGAGGG + Intergenic
1097714761 12:62954675-62954697 CTCTGCATGTGGAAAGAGGCAGG - Intergenic
1097769983 12:63572331-63572353 CTCTGCCTGGGGAAAGGGGAAGG + Intronic
1097899201 12:64856828-64856850 TTCTGCCTGTGGTATGGGGAGGG - Intronic
1098142863 12:67468961-67468983 CTCTGCCTGTGGAAAGGGAAGGG - Intergenic
1098209494 12:68148771-68148793 CTGTGGCTCTGGCAGGGGGAGGG - Intergenic
1098667284 12:73180126-73180148 CTCAGCCTGGGGAAAGGTGAGGG - Intergenic
1098884337 12:75945143-75945165 CTGTGAATGTGGACATGGGAAGG - Intergenic
1099495371 12:83339935-83339957 CTCTGCCTTTGGTAAGTGGAGGG + Intergenic
1099564864 12:84230389-84230411 CTCTGCCTTTGGAAAGAAGAGGG - Intergenic
1099610040 12:84856999-84857021 CTCTGACTGAGGAAAGAGGAGGG - Intergenic
1099616189 12:84938592-84938614 CTCTGCTTGTGTAAAGGGGAGGG + Intergenic
1099764105 12:86960561-86960583 CTTTGCCTGTGGAAAGGAGAGGG - Intergenic
1100360742 12:93877585-93877607 CTCTGCCTTTGGAAGGGGAAAGG - Intronic
1100875767 12:98959891-98959913 CTCTGTTTGTGGAAAGGGGAGGG + Intronic
1101083091 12:101208995-101209017 CTGTTTCAGTGGAAAGGGGGTGG + Intronic
1101087224 12:101248805-101248827 ATGAGAATGTGGAAAGGGGAGGG - Intergenic
1101162572 12:101994087-101994109 CTCTGCCTGTAGAAATGGGAGGG - Intronic
1101226727 12:102694795-102694817 CTCTGCCTTTGGAAAGTGTAGGG + Intergenic
1101251919 12:102945534-102945556 CTCTGTTTGTGGAAAGGGGAGGG - Intronic
1101376031 12:104172276-104172298 CGGGGCCTGTGGAAAGGGGGCGG + Intergenic
1101780644 12:107832097-107832119 CATTGTCTTTGGAAAGGGGAGGG - Intergenic
1102318008 12:111905389-111905411 CTCTGCCTTTGGAAAGGGAAAGG + Intergenic
1102742415 12:115219868-115219890 CTGGGCCGGTGGAGAGGGGAAGG - Intergenic
1103867497 12:124064492-124064514 CTGTGTTTTGGGAAAGGGGAGGG + Intronic
1103917846 12:124385186-124385208 CTGTGCTTGTGGAGGAGGGAAGG + Intronic
1104103094 12:125634164-125634186 CTCTGCATTTGGAAAGGCGAAGG - Intronic
1104710804 12:130984540-130984562 CTGTGCCTGTGTAGAGGCGGAGG - Intronic
1104861983 12:131928855-131928877 CAGCGTCTGTGGAACGGGGACGG + Intergenic
1104923353 12:132302794-132302816 CTGTGGCAGCAGAAAGGGGACGG + Intronic
1105299250 13:19117878-19117900 CTCTGCCTGTGGTAGGGGGCTGG - Intergenic
1105547020 13:21358189-21358211 CTGTGCATGTGTAGGGGGGAAGG + Intergenic
1106074715 13:26448311-26448333 CTCTGCTTGAGGAAAGGAGAAGG + Intergenic
1106349923 13:28920786-28920808 CTCTGCCTATGGAAAGGGAAGGG - Intronic
1106645463 13:31629535-31629557 CTCTGCTTTTGGAAAGAGGAAGG - Intergenic
1107178161 13:37423506-37423528 TTCTACCTGTGGAAAGAGGAGGG + Intergenic
1107210919 13:37852872-37852894 CTTTGCCTGTGAAAAGGAGAAGG + Intronic
1107524151 13:41213774-41213796 CTCTGCTTGTGGAAAGGGGAGGG - Intergenic
1107754106 13:43600442-43600464 CTCTGCTGGTGGAAAGGAGAGGG + Intronic
1107807812 13:44171651-44171673 CTCTGCTTTTGGAAAGAGGAGGG - Intergenic
1107808181 13:44174465-44174487 CTCTGCTTGAGGAAAGGGGAGGG - Intergenic
1108003544 13:45925839-45925861 CTGTGTGTGTGGTAAGGGGCTGG + Intergenic
1108660198 13:52578104-52578126 ATGTGTCTGTGTAGAGGGGATGG + Intergenic
1108962104 13:56247216-56247238 CTTTATCTGTGGAAAGGGGAGGG - Intergenic
1109100654 13:58180603-58180625 CTCTGCTTGTGGGAAGGGGAGGG - Intergenic
1109336635 13:61003221-61003243 CTCTGCCTGTGAAAAGGGGAGGG - Intergenic
1109522690 13:63533812-63533834 CTCTGCCTTTGGAAAGAGAAGGG - Intergenic
1109567124 13:64131884-64131906 CTCTGCCTATGGAAAGGAAAGGG + Intergenic
1109685894 13:65819184-65819206 CTCTTTCTTTGGAAAGGGGAGGG + Intergenic
1109826393 13:67727764-67727786 CCATGCCTTTGGAAAAGGGAGGG - Intergenic
1110376786 13:74802980-74803002 CTCTGCTTATGGCAAGGGGAAGG + Intergenic
1110501359 13:76231750-76231772 CTCTGCCTTTGGAAAGAGGAGGG + Intergenic
1110886041 13:80636820-80636842 CTCTGCTTGTGGAAATGAGAGGG - Intergenic
1110889472 13:80680247-80680269 CTCTGCCTTTGGAAAGGGGAGGG - Intergenic
1110916746 13:81030608-81030630 CTCTGCCTGGGGAAAGGAGATGG - Intergenic
1111531283 13:89541102-89541124 CTGCCCCTATGGAATGGGGAAGG - Intergenic
1111542769 13:89689873-89689895 CTCTGCCTGTGGAATGGGGAGGG + Intergenic
1111913103 13:94333776-94333798 CTGTTGCAGTGGAAAGGGAATGG - Intronic
1112053744 13:95670978-95671000 CTCTGCCTGGTGAAAGAGGAGGG - Intergenic
1112618821 13:101034418-101034440 CTTTGCCTTTGGAAAGGGGAAGG - Intergenic
1112901437 13:104362787-104362809 CTCTGCTTTTGGAAAGGGGAGGG - Intergenic
1113175067 13:107554541-107554563 CTGGGCCTCTGATAAGGGGAAGG - Intronic
1113633194 13:111901808-111901830 CTCTCCCTGTGGAAGGGGGCAGG + Intergenic
1114248124 14:20933741-20933763 CTCTGCCCATGGAAAGGTGAAGG + Intergenic
1114250954 14:20959821-20959843 CTCTGCCCGTGGAAAGGTAAGGG + Intergenic
1114506330 14:23217269-23217291 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
1114563955 14:23614535-23614557 CTTTGCCTGCTGACAGGGGATGG + Intergenic
1115133965 14:30086738-30086760 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
1115620276 14:35134215-35134237 CTCTGCTTTTGGAAACGGGAGGG - Intronic
1115821052 14:37212485-37212507 CTCTGCCTTTGGAAAGGGGAGGG + Intronic
1116021582 14:39468618-39468640 CTCTGCCTGTGGAAAGTGGAGGG - Intergenic
1116057931 14:39886291-39886313 CTCTGCCTTGGGAAAGGGGAGGG + Intergenic
1116141152 14:40995590-40995612 CACTGCCTGTGGCTAGGGGAGGG + Intergenic
1116192643 14:41680022-41680044 CACTGCTTGTGGACAGGGGAGGG + Intronic
1116354821 14:43914769-43914791 TTGTGCTTGAGGAAAGGAGAGGG + Intergenic
1116407117 14:44579609-44579631 CTCTGCCTTTGGAAAGGAGAGGG + Intergenic
1116434107 14:44877495-44877517 CTCTGCCTGTGGAAAGGGGAGGG + Intergenic
1116481131 14:45392406-45392428 CTCTGCCTGTGGAAAGGGGAGGG + Intergenic
1116489767 14:45492265-45492287 CTCAGTCTTTGGAAAGGGGAGGG - Intergenic
1116497742 14:45582977-45582999 CTCTGCCTGAGGAAAGTGGAGGG - Intergenic
1116785815 14:49287713-49287735 TTTTGCCTGTGGAAAGGGTAGGG - Intergenic
1116889190 14:50250399-50250421 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
1117159321 14:52973406-52973428 CTGTGCCTTTGGAAAAGGGGAGG - Intergenic
1117234042 14:53752641-53752663 CTCTGCCTGCAGAAAGGGAAAGG + Intergenic
1117264867 14:54076538-54076560 CTCTGCCTTTGAAAAGGGGAGGG - Intergenic
1117384202 14:55194772-55194794 CTCTGCCTGTGGAAAGGGAAGGG - Intergenic
1117606933 14:57439905-57439927 CTCTGCTTGTGGAAAGATGAGGG - Intergenic
1117642159 14:57811460-57811482 CTTTGAAGGTGGAAAGGGGAAGG - Intronic
1118543602 14:66858913-66858935 CTCTGCCTGTGGAAAATAGAGGG + Intronic
1118956710 14:70489307-70489329 CTCTGCCTTTGGAAAGGGGAGGG + Intergenic
1119266253 14:73264693-73264715 CTGTGGGTGTGAAGAGGGGATGG - Exonic
1119693361 14:76694027-76694049 CTGTGCCTGAGGCAGGGGGCTGG + Intergenic
1120275834 14:82371123-82371145 CTCTTCCTGGGGAAAGGGGAGGG + Intergenic
1121018253 14:90561819-90561841 CTGGGGCTGTGGAAACAGGAGGG + Intronic
1121237258 14:92401242-92401264 CTGTGCTGGTAGATAGGGGAGGG + Intronic
1121518500 14:94569832-94569854 TTCTGCCTCTGGAAAGGGGGCGG + Exonic
1121916574 14:97841152-97841174 CTCTGCATGTGGAAGGGGAATGG - Intergenic
1122503067 14:102214031-102214053 CGGTGCCGGTGGATGGGGGAGGG + Intronic
1122637507 14:103137231-103137253 CAGTACCTGGGAAAAGGGGACGG - Exonic
1122811040 14:104288043-104288065 CTGTGCCTCCGGGCAGGGGAGGG + Intergenic
1123508587 15:20972089-20972111 CTCTGCCTGTGGAAGGAAGAGGG - Intergenic
1123565809 15:21545838-21545860 CTCTGCCTGTGGAAAGAAGAGGG - Intergenic
1123602071 15:21983125-21983147 CTCTGCCTGTGGAAAGAAGAGGG - Intergenic
1123990015 15:25676209-25676231 CTGTGCCTTCGGTAAGGGGCCGG - Intergenic
1124081329 15:26501040-26501062 CTCTGCCTTTGGAAAGGGAAGGG - Intergenic
1124356250 15:28996884-28996906 CTGTGCCAGTTGTGAGGGGACGG + Intronic
1124646930 15:31443836-31443858 CTGTGCCCTTGGCAATGGGACGG - Intergenic
1125044437 15:35230256-35230278 CTCTGCCTTTGGAAAGGGGAAGG - Intronic
1125272348 15:37952973-37952995 CTCTGCTTTTGGAAAGGGGAGGG + Intronic
1126053266 15:44706988-44707010 CTCAGCTTGTGGAAAGGGGAGGG - Intronic
1126183834 15:45811370-45811392 CTCTGCCTTTGGAAAGGAGAAGG + Intergenic
1126440603 15:48683902-48683924 CTCTGCCTGGGGAAAGTGGAGGG + Intergenic
1126517568 15:49553632-49553654 CTCTGCCTTTGGAAAGGGGAGGG - Intronic
1126534203 15:49742664-49742686 CTCTGCGTGTGGAAAGGGGAGGG + Intergenic
1126578683 15:50222250-50222272 CTGTCCCAGTGGGATGGGGAGGG - Intronic
1126709389 15:51440866-51440888 CTCTCCCTTTGGAAAGGGGAGGG - Intergenic
1127034023 15:54895314-54895336 CTCTGCTTGTGTAAAGGGAAAGG - Intergenic
1127035246 15:54908712-54908734 CTGTGCCTTTGGAAAGAGGAGGG + Intergenic
1127132666 15:55883292-55883314 CTCTGCCTGTGGAAAGAGAAGGG + Intronic
1127155692 15:56122767-56122789 CTCTGACTAGGGAAAGGGGAAGG - Intronic
1127971466 15:63965688-63965710 CTCCGCTTGTGGAAAGGGGAGGG - Intronic
1128900998 15:71422923-71422945 CTCTGCTTGCAGAAAGGGGAAGG - Intronic
1128943988 15:71809441-71809463 CTGCTCCTGTGGGAAGGAGAGGG - Intronic
1129030560 15:72614944-72614966 CTCTGCCTGTGAAAAGGGAAAGG - Intergenic
1129209666 15:74060356-74060378 CTCTGCCTGTGGAAAGGGAAAGG + Intergenic
1129501120 15:76038521-76038543 CTCTGCCTGTGAAAAGGAGAGGG + Intronic
1129561652 15:76577122-76577144 CTATGCTTGAGGAGAGGGGAGGG + Intronic
1129561816 15:76578112-76578134 CTATGACTATAGAAAGGGGAGGG + Intronic
1129642455 15:77394036-77394058 CTCTGCTTGTGGAAAGGGAAGGG + Intronic
1129700207 15:77763407-77763429 CAGTGACTGGGGAGAGGGGATGG - Intronic
1129808056 15:78481138-78481160 CTGTCCCTAGAGAAAGGGGATGG + Intronic
1129835459 15:78702717-78702739 CTCCTCCTGTGGAATGGGGAAGG - Intronic
1129882558 15:79016866-79016888 CTGTGCCTGTAGAAACTGAAAGG - Intronic
1130130400 15:81136346-81136368 CTTTGCCTTGGCAAAGGGGAAGG + Intronic
1130136387 15:81185046-81185068 CTGGGCCTGTGGGAAGCAGAGGG + Intronic
1130441098 15:83955253-83955275 CTCTGCCTGTGGAAAGGGGAGGG - Intronic
1130511854 15:84595884-84595906 CTCTGCCTGTGGAAAGGGGAAGG + Intergenic
1131195701 15:90352824-90352846 CTGTGCATGGGGAAAGGGACGGG + Intronic
1131302835 15:91214734-91214756 GTGAGCCAGTGGAATGGGGAAGG - Intronic
1131315043 15:91328688-91328710 CTCTGCTTGAGGAAAGAGGAGGG - Intergenic
1131345898 15:91647812-91647834 GTGTGTTTGTGGAAAGGAGAAGG + Intergenic
1131373463 15:91903920-91903942 GTGTGCTTGTGGAGAGGGCAGGG + Intronic
1131651932 15:94409733-94409755 CACTGCTTGTGGGAAGGGGATGG - Intronic
1131950120 15:97672980-97673002 CTCTGCCTTTGGAGAGAGGAGGG - Intergenic
1132375045 15:101323310-101323332 CTGTGCCCTTGGGAAGGGGGTGG + Intronic
1202974178 15_KI270727v1_random:272931-272953 CTCTGCCTGTGGAAAGAAGAGGG - Intergenic
1133911645 16:10071570-10071592 CTGTGCCTATAGAAAGGGATTGG + Intronic
1135463135 16:22662350-22662372 CTGTACCTCTGGAAAAGGCAAGG - Intergenic
1135913191 16:26579514-26579536 CAGTGCCTGAGAAAAGGGCAAGG + Intergenic
1136389114 16:29951217-29951239 CTCTGTCCATGGAAAGGGGAAGG - Intronic
1136497773 16:30654612-30654634 CTGGGGCTGAGGAAAGGAGAGGG - Exonic
1136545344 16:30951149-30951171 CTGGGCCTGGGGAAAGAAGAAGG - Intronic
1136676543 16:31913682-31913704 CTCTGCCTGCAGAAAGGGGAGGG - Intronic
1137225749 16:46506651-46506673 CTCTGCCTGGGGAAATGGGAGGG + Intergenic
1137615023 16:49841275-49841297 TTGTGCCTGGGGATAGGAGAAGG - Intronic
1138427689 16:56947141-56947163 CTCTGCCTGTGCAAAGGCGGAGG + Intergenic
1138501991 16:57452295-57452317 CCGTGCCTATGGGGAGGGGAAGG + Intronic
1138806779 16:60099836-60099858 CTCTACTTGTGAAAAGGGGAGGG - Intergenic
1139103760 16:63801692-63801714 CTCTGCCTTTGTAAAGGGGAGGG - Intergenic
1139630949 16:68231614-68231636 AGGTGCCAGTGGGAAGGGGATGG + Exonic
1140473355 16:75226863-75226885 CTCTGCCTGTGGCCGGGGGATGG - Intergenic
1140508312 16:75488587-75488609 CTGGGCATTTGGAAGGGGGAAGG + Intronic
1140646575 16:77038092-77038114 TTCTGCCTTTGGAAGGGGGAGGG - Intergenic
1141138690 16:81483233-81483255 CTGTGCATGTGCAAAGGCCATGG + Intronic
1141469049 16:84226115-84226137 CTCTGCCTGTGGCAAGGGCTAGG - Intronic
1141476872 16:84279965-84279987 CTGTTCTTGAGGAAAGGGAAAGG + Intergenic
1142067582 16:88071609-88071631 CTCTGCCTTGGGAATGGGGAGGG + Intronic
1142110734 16:88329703-88329725 CTGTTCCAGGGGAAAGGGGACGG + Intergenic
1142128477 16:88421596-88421618 CTGGGGCAGAGGAAAGGGGATGG + Intergenic
1143594770 17:7907584-7907606 CTGTGGCTGTGGGAGGGGGTAGG - Exonic
1144070201 17:11664597-11664619 CTGTCCCTGAGGAAGGAGGATGG - Intronic
1144286208 17:13777302-13777324 CTGTGCGGTTGGAAAAGGGACGG - Intergenic
1144698801 17:17323312-17323334 GCCTGCCTGTGGAAAGGGGATGG + Intronic
1144743432 17:17597163-17597185 CCGTGTCTGTGGAATGGGGAGGG + Intergenic
1144760325 17:17703506-17703528 CTGTGGCTCTGGAAAGGTGTTGG + Intronic
1144833353 17:18143853-18143875 CGAGGCCTGTGGAAAGAGGAGGG - Exonic
1145023905 17:19453356-19453378 CTGTGGCTGTGGACAGGAGCTGG + Intergenic
1145980877 17:29010790-29010812 CTGAGCCTGTGCAGAGGTGACGG + Intronic
1146749971 17:35369369-35369391 CTCTGCCTGTGGAAAAAGGAGGG + Intronic
1147314657 17:39613859-39613881 CTGAGCCTGCTGAAAGGTGAAGG - Intergenic
1147460529 17:40565322-40565344 CTGACCCTGTGGAATGGGGGTGG - Intronic
1147959547 17:44158211-44158233 CTGTCCATCTGGACAGGGGATGG - Intronic
1148836861 17:50469947-50469969 GGATTCCTGTGGAAAGGGGAGGG + Intronic
1149075621 17:52594265-52594287 CTCTGCTTGAGGAAAGGAGAGGG - Intergenic
1149239837 17:54635966-54635988 CTCTGCCTGTGGAAAGAGGTAGG + Intergenic
1150422375 17:65049686-65049708 CTGTTCCTGGGGAAAGGGAGGGG + Intronic
1151770729 17:76158920-76158942 CTGTGGCAGAGTAAAGGGGAGGG - Intronic
1152288980 17:79428216-79428238 CTGTGACTGTGGAGATGGGAGGG - Intronic
1152603585 17:81277783-81277805 CTGGGCCTCTGGAAAGGGGTGGG + Intronic
1152696953 17:81802394-81802416 CTGTGCCTCTGGAGAGGTGGGGG + Intergenic
1152710505 17:81868679-81868701 CTGGGCCTGTGGGTGGGGGAGGG + Exonic
1152797593 17:82315760-82315782 GTGTGGCCGTGGGAAGGGGAGGG - Intronic
1153074717 18:1148929-1148951 CTCTGCCTTTGGAAAGGGGAGGG + Intergenic
1153356542 18:4143350-4143372 TTCTGCTTGTGGAAAAGGGAGGG - Intronic
1153389146 18:4534626-4534648 CTCTGCCTTTGGAAAGGGGAGGG - Intergenic
1153425791 18:4961464-4961486 CTCTGCCTTTGGCAAGGGGAGGG + Intergenic
1153429557 18:5000566-5000588 CTCTGCCTGAGTAAAGGGGAGGG + Intergenic
1153714986 18:7838903-7838925 CTCTGCCTTTGGAAAGGGGAGGG - Intronic
1154038934 18:10834715-10834737 CTGGCCTTGTGGAAAGGGAAGGG - Intronic
1154041430 18:10859858-10859880 CTGTGCTGGAGGAGAGGGGAGGG + Intronic
1155081487 18:22414646-22414668 CTCTTGCTGTGGCAAGGGGAAGG - Exonic
1155110699 18:22711279-22711301 CTGTGACTTGGGAAAGGGAAGGG - Intergenic
1155224174 18:23714012-23714034 GTGTGCCTGAGGACAGGGGAGGG - Exonic
1155282194 18:24251017-24251039 CTGTGCCTGTGGAAAGGGGAGGG + Intronic
1155533855 18:26795255-26795277 TTCTGCCTTTGGAAAGGGGAGGG + Intergenic
1155597346 18:27502900-27502922 CTCTGCCTTTGGAAAGGAGAGGG + Intergenic
1155767445 18:29653068-29653090 CTCTGCCTGTGAAAAGGGGAAGG + Intergenic
1155782015 18:29849254-29849276 TTCTGCCTTTGGAAAGGGGAGGG - Intergenic
1156025954 18:32655412-32655434 CTTTGCCTTTTGAAAGGGGAAGG - Intergenic
1156094307 18:33510665-33510687 CTCTGACTGTGGAAAGGGAAAGG + Intergenic
1156141364 18:34115488-34115510 CTGTGCATGTGCTAAGGGGGAGG - Intronic
1156155904 18:34301365-34301387 CTCTGACTGTGAAAAGGGGAGGG + Intergenic
1156641362 18:39104167-39104189 CTGAGGCTGTTGAAAGTGGAGGG + Intergenic
1156912325 18:42425743-42425765 CTCTGACTGTGGAAAGAGGAGGG - Intergenic
1157065200 18:44341706-44341728 CTCTGCCTGGGGAAAAGGGAGGG - Intergenic
1157903377 18:51542631-51542653 CTGTGCCTGCAGGGAGGGGATGG - Intergenic
1158024936 18:52885392-52885414 CTCTGTCTATGGACAGGGGAGGG - Intronic
1158481217 18:57823644-57823666 CTCTGCCTGGGGAAAGGGGAGGG - Intergenic
1158948952 18:62474449-62474471 ATCTGCCTGTGGAAAGGGGAGGG - Intergenic
1159080685 18:63731842-63731864 CTCTGCCTGTGGAAAGGGGAGGG + Intergenic
1159775282 18:72597777-72597799 CTTTGCTTGTGTAAAGGAGAAGG - Intronic
1159905162 18:74083246-74083268 CTATGCCTGGGGAGAGTGGAAGG - Intronic
1159907375 18:74107766-74107788 CTATTCCTCTGGAAAAGGGAGGG + Intronic
1159948007 18:74457871-74457893 GGGTGCCCGTGGGAAGGGGAGGG - Intronic
1160251013 18:77203455-77203477 ATGGGCCTGTGGAATGGGGGTGG + Intergenic
1160382141 18:78468004-78468026 CTCTGCCTCTGGATAGGGAAGGG + Intergenic
1160799211 19:960069-960091 CTGTGAGGGTGGAGAGGGGATGG - Intronic
1160865374 19:1253764-1253786 CTCTGCCTGTGGATACGGGAGGG - Intronic
1160972115 19:1774162-1774184 CTCAGCCTGTGGATAGGGGCAGG + Intronic
1161570038 19:5025488-5025510 CTCTGGCTGTGGGAAGTGGATGG - Intronic
1161981663 19:7633266-7633288 TTGTGGCTGTAGAAAGGGGCTGG - Intronic
1161990092 19:7679844-7679866 CTGTTACTGGGGCAAGGGGAGGG + Intronic
1162340682 19:10089881-10089903 CACTGCCTGTGGAATGGGGCAGG - Exonic
1162552329 19:11364625-11364647 TTGTCCCGGTGGAAGGGGGAGGG - Exonic
1162692965 19:12449198-12449220 CTCTGCCTGTGGAAAGGGGAGGG - Intronic
1164408612 19:27977281-27977303 CTCTGCCTGGGTAATGGGGAAGG + Intergenic
1164546956 19:29173857-29173879 CTCTGCCTGTGGAAAAGGAAGGG + Intergenic
1165038913 19:33055014-33055036 CTGTGGCCTTGGAGAGGGGAGGG - Intronic
1165645474 19:37431940-37431962 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
1165775975 19:38404496-38404518 CTGTGCCTGGGCAAAGGTGGAGG + Intronic
1165846200 19:38819290-38819312 CTGTGGCTGTTGAAGAGGGAGGG - Intronic
1165956277 19:39503785-39503807 CTGTGCTCTTGGAAAGAGGATGG - Intronic
1166409500 19:42547167-42547189 CTGTGTCTGGGGGAAGGGGCTGG + Intronic
1166663256 19:44661275-44661297 CTGTACCTGGGGAAATAGGAGGG - Exonic
1167108844 19:47447252-47447274 CGGTGGCTGTGGAGAGGGGGCGG - Intronic
1167363003 19:49040112-49040134 AGGGGCCTCTGGAAAGGGGACGG + Intergenic
1167582131 19:50351379-50351401 CTCTGCCTGTGGCAAAGGGAGGG - Intronic
1168122442 19:54259408-54259430 CTTTGCCTTAAGAAAGGGGAGGG - Intronic
1168153238 19:54460188-54460210 CTGTGTGTGTGGAAAGGGTAGGG + Intronic
1168615383 19:57833280-57833302 CTCTGCCTGTGGAAAGGGGATGG - Intronic
1168621401 19:57882167-57882189 CTCTGCCTGTGGAAAGGGGATGG + Intronic
1202703803 1_KI270713v1_random:6086-6108 GCTTGCCTGGGGAAAGGGGAAGG - Intergenic
925249612 2:2421420-2421442 CTCTGCCTTTGGAAAGCGGAGGG - Intergenic
925275990 2:2648888-2648910 CTGCTCCTGTCGAAAGGGAATGG + Intergenic
925641853 2:5993038-5993060 CTTCTCCTGTAGAAAGGGGAAGG - Intergenic
925843269 2:8012198-8012220 CTGTCCCTGTGGAAAGGGAAAGG - Intergenic
926139343 2:10359163-10359185 CTGTGGCTGTGAAACGGGAAAGG - Intronic
926204721 2:10828014-10828036 CTGTGTGTGTGGCAGGGGGAGGG - Intronic
926478401 2:13357164-13357186 CTCTGTCTTTAGAAAGGGGAGGG + Intergenic
926600973 2:14844812-14844834 CCCTGCCATTGGAAAGGGGAGGG + Intergenic
926602091 2:14855678-14855700 CTGTCCCTTTGGAAATGGGAGGG + Intergenic
926890733 2:17637123-17637145 CCTTCCCTGTGGGAAGGGGAAGG - Intronic
927570209 2:24152927-24152949 CTCTGCCTGTGTAAAGGGGAGGG - Intronic
928054747 2:28041628-28041650 GTGTGCCTGTGTTCAGGGGATGG - Intronic
928091719 2:28378610-28378632 GTGTGCCTATGGCAGGGGGAGGG + Intergenic
928270293 2:29849372-29849394 CTGTGCATGTGGTAAGAAGAGGG + Intronic
928293601 2:30061540-30061562 CTCTGCCTGTGGAAAGGGGAAGG + Intergenic
928458936 2:31451256-31451278 CTCTGCCTTTGGAAAGGGGAGGG + Intergenic
928715481 2:34055631-34055653 CTCTGCTTGAGGAAAGGAGAGGG - Intergenic
928802965 2:35116089-35116111 CTCTGCCTTTGAAAAGGAGAGGG + Intergenic
928828874 2:35455113-35455135 CTCTGCCTTTGGAAAGGAAATGG - Intergenic
928862414 2:35874867-35874889 CTCAGCCTTTGGAAAGGGGAGGG - Intergenic
928864040 2:35895936-35895958 CTCTGACTGAGGAAAGGAGAGGG - Intergenic
928932393 2:36637557-36637579 CTCTGCTTGAGGAAAGGGGAGGG + Intronic
928998369 2:37321473-37321495 GTGTGCATGGGGGAAGGGGAAGG - Intronic
929281677 2:40087160-40087182 CTCTGCTTGTGGAAAGGGGAAGG - Intergenic
929388598 2:41442095-41442117 CTCTGCCTTTGGAAAGAGGAGGG - Intergenic
929524970 2:42693474-42693496 CTCTGCCTGTGGAAAGGGGAAGG - Intronic
929553080 2:42906565-42906587 CTGTGCCTGTGGGGCGGGGCTGG + Intergenic
929567907 2:43000981-43001003 CTGTGCCTGTGGGCCTGGGAAGG + Intergenic
929602542 2:43213350-43213372 AAGTGCCAGTGGAGAGGGGAAGG - Intergenic
929926501 2:46216805-46216827 CTCTGGCTTTGGAAAGGGGAGGG - Intergenic
930288794 2:49467709-49467731 TTCTGGCTGTGGAAAGGGGAGGG - Intergenic
930439619 2:51390166-51390188 CTCTGCCTGTGGAAAGGGGAGGG - Intergenic
930475511 2:51876210-51876232 CTCTGCCTATGGAAAGGGGAAGG + Intergenic
930727459 2:54695640-54695662 CTCTGCCTTTGGAAAGGGGAGGG + Intergenic
930944829 2:57061297-57061319 CTGTGCCTGTGGAAAGGGGAGGG - Intergenic
930970252 2:57386212-57386234 CTCTGCCTGCAGAAAGAGGAAGG + Intergenic
931001832 2:57793800-57793822 CACTGCCTTTGGAAAAGGGAGGG - Intergenic
931572322 2:63681452-63681474 CTCTTCCTTTGGAAAGGGGTAGG + Intronic
932820328 2:74894371-74894393 CTGGGACTGTGGAATGGGGTGGG + Intergenic
932921089 2:75916366-75916388 CTGTGCCTGAGGAAAGGGAAGGG - Intergenic
933387903 2:81634639-81634661 CTCTGCCTTTGGAAAGGAGAAGG + Intergenic
933629559 2:84640250-84640272 CTGTGCCACAGGAAACGGGAAGG - Intronic
933653189 2:84865500-84865522 CTTTGCATGTGGAAAGCAGAGGG + Intronic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
934104978 2:88687257-88687279 CTGCCCTTGTGAAAAGGGGATGG + Intergenic
934115448 2:88786957-88786979 ATGTTTCTATGGAAAGGGGAAGG + Intergenic
934628136 2:95881978-95882000 ATGTTTCTATGGAAAGGGGAAGG - Intronic
934805270 2:97217674-97217696 ATGTTTCTATGGAAAGGGGAAGG + Intronic
934832089 2:97537844-97537866 ATGTTTCTATGGAAAGGGGAAGG - Intronic
934870626 2:97861628-97861650 TTCTGCCTGTGGAAAGGGGAGGG + Intronic
935078559 2:99770218-99770240 TTCTGCCTGTGGAAAGGAGAGGG - Intronic
935356550 2:102206979-102207001 CTCTGCCTTTGGAAAGGGGAGGG - Intronic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935928188 2:108093355-108093377 CTTTGCTTTTGGAAAGGGGAAGG - Intergenic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936024189 2:109018692-109018714 GAGTGCCAGTGGAAAGGGGATGG - Intergenic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936233447 2:110724367-110724389 CTGTGGCTGTGTGGAGGGGAGGG + Intergenic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936511227 2:113149317-113149339 CTTTGCTTATGGAAAGGGGAGGG - Intergenic
936940340 2:117878216-117878238 CTCTTCTTGTGGAAAGGGGAGGG - Intergenic
936942740 2:117902581-117902603 TTGTGCTTTTGGCAAGGGGAAGG - Intergenic
936986465 2:118315581-118315603 CTTTGCCTGTGGAAATTGAATGG + Intergenic
937060530 2:118977588-118977610 GTGGGGCTGTGGAAAGAGGATGG - Intronic
937393574 2:121514763-121514785 CTGGGCATCTGGAAATGGGATGG - Intronic
937512557 2:122612168-122612190 CTCTGCCTGTGGAAAGATAAAGG + Intergenic
937613512 2:123892872-123892894 TTCTCCCTGTGGAAAGGTGAGGG - Intergenic
937628388 2:124069249-124069271 CTCTGACTGTGGAAGGGGGAAGG + Intronic
937793921 2:125994653-125994675 CTCTGCTTCTGGAAAGGGGATGG - Intergenic
937839408 2:126510829-126510851 CTGTGACTGAGGAAAGAGGAAGG - Intergenic
938654924 2:133421596-133421618 CTGTGCCTGTGGCTTGGAGATGG - Intronic
939133531 2:138266919-138266941 TTTTGCCTGTGTAAAGGAGAAGG + Intergenic
939244755 2:139609583-139609605 CTCTGCCTTTGGAAAGGGAGGGG - Intergenic
939405009 2:141745415-141745437 CTCTGCCAGTGGAAGGGGGAGGG - Intronic
939443146 2:142275664-142275686 CTGTGCCTTTGGAAAGGGGAAGG - Intergenic
939552352 2:143630973-143630995 CAGAGCAGGTGGAAAGGGGAAGG - Intronic
939800483 2:146700837-146700859 CTCTGCCTTCAGAAAGGGGAAGG + Intergenic
940029610 2:149247693-149247715 CTTTGGCTGGGGAAAGGGCAGGG - Intergenic
940315119 2:152320259-152320281 CTCTGCCTTTGGAAAGGAGAAGG - Intergenic
940343283 2:152603153-152603175 CTGTGCCTGTGGAATGTGTCAGG + Intronic
940433433 2:153621683-153621705 CTCTGCCTTTGGAAAGGTGAGGG - Intergenic
940503727 2:154527117-154527139 CTTTGCCTTTGGAAAGGGGAGGG - Intergenic
940560396 2:155288065-155288087 CTCTGTCTTTGGAAAGGGGAAGG + Intergenic
940795456 2:158072238-158072260 CTCTGCCAGTGGAAAAGGGAGGG + Intronic
941070779 2:160952040-160952062 ATGTTCCTGTGGGAAGGGTAAGG - Intergenic
941296189 2:163741286-163741308 CTGTGCCTGTGGAAAGCAAAGGG - Intergenic
941528197 2:166631999-166632021 CTCTGCCTGGGGAAAGGGGAGGG - Intergenic
941672521 2:168310339-168310361 CTCTGCCTGTGGAAAGGGGAAGG - Intergenic
941678663 2:168371506-168371528 CTCTGCCTGTGAAAAGCAGAAGG + Intergenic
941745252 2:169080323-169080345 CTGAGCCTGTGGAAGGGAGAGGG - Intronic
941745909 2:169087216-169087238 CTCTGCTTGTGAAAAGGGGAGGG - Intronic
941771373 2:169349418-169349440 CTGTGCATGGGGAGAGGAGAAGG + Intronic
941934218 2:170970722-170970744 CTGAGTCTGGGGAGAGGGGAGGG + Intergenic
942734643 2:179096418-179096440 CTCTGCCTTCGGAAAGGGGAAGG - Intergenic
942972207 2:181970808-181970830 CTCTGCTTGTGGAAAGGAGATGG - Intronic
943118898 2:183709967-183709989 CTCTGCCTTTGGAAAGGGAAGGG - Intergenic
943129734 2:183840289-183840311 CTGTTCCAGTGGAGATGGGAGGG - Intergenic
943240917 2:185382844-185382866 CTGTGTGTGTGGGAAGGGGTGGG - Intergenic
943427834 2:187758908-187758930 CTCTACCTGTGGAAATGGAATGG - Intergenic
943851571 2:192729836-192729858 GTGTGCCTGTGGAAAAGCGCAGG - Intergenic
944044362 2:195391849-195391871 CAGTGCTGGTGGAAAGGGGTGGG - Intergenic
944616340 2:201464827-201464849 TTCTGCCTGAGGAAAGGAGAGGG - Intronic
944866783 2:203870432-203870454 CTGGGGGTGTGGAGAGGGGAAGG + Intronic
944990471 2:205229881-205229903 CTCTGCTTGTGGAAAGAAGAGGG - Intronic
945198206 2:207257013-207257035 CTGTGCATGTGGCAGGGGGAAGG + Intergenic
945403683 2:209420918-209420940 CTGTCCCTGAGAAAAGGGTATGG + Intergenic
945461617 2:210116197-210116219 CTCTGCTTGAGGAAAGAGGAAGG + Intronic
945575708 2:211525854-211525876 CCCTTCCTGTGGAAAGGGGAGGG + Intronic
945803739 2:214465176-214465198 TTCTGCCTGAGGAAAGGAGAGGG - Intronic
946697329 2:222372644-222372666 CTCTGTCTGTGGAAAAGGGAGGG + Intergenic
947312291 2:228817915-228817937 CTCTGCCTTTAGAAAGGAGAGGG - Intergenic
947687068 2:232097477-232097499 CTCTGCCTGTGGAAAGGGGAGGG - Intronic
947747532 2:232516664-232516686 CTGGGCCTCTGGAAATGGAAAGG - Intergenic
947859559 2:233348972-233348994 CTGTGGCAGAGGACAGGGGAAGG - Intergenic
948590134 2:239044095-239044117 CTGTGCCAGTGGGAAGGCGGAGG - Intergenic
1168742011 20:200129-200151 CTCTGCTTTTGGAAAGGAGAGGG - Intergenic
1168766024 20:381874-381896 CTGTGCCTGCAGACCGGGGAGGG + Intronic
1168899864 20:1354488-1354510 CTCTGCCTGAGGAAAGGGGAGGG - Intronic
1169720162 20:8667521-8667543 CTGGGCCTGAGGAAAGGCAAAGG + Intronic
1170086902 20:12544209-12544231 CTCTGCCTTTGGAGAGGGGAAGG - Intergenic
1170118141 20:12883408-12883430 CAGGGACTGTGGAAATGGGAAGG + Intergenic
1170236090 20:14106308-14106330 CTCTGCCTTTGGAAAGGGGAAGG + Intronic
1170668455 20:18406965-18406987 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
1170756672 20:19212063-19212085 CTGTGCCAGGGGAAGAGGGACGG - Intergenic
1171133773 20:22678441-22678463 CTGTCCCTCTGGACAGGGAAAGG + Intergenic
1171938028 20:31294231-31294253 CTCTGCCTTTGGAAAGGGGATGG + Intergenic
1172327722 20:34049899-34049921 TGGTGACTGTGAAAAGGGGAAGG - Intronic
1172714400 20:36951927-36951949 CAGTGCTGGTGGAAAGGGGGAGG + Intergenic
1172929128 20:38570300-38570322 CAGGACCTTTGGAAAGGGGAAGG + Intronic
1172966934 20:38842690-38842712 CTGTGCCTGGGGGTGGGGGAGGG - Intronic
1173004099 20:39126640-39126662 TTCTGCCTTTGGAAAGGGGAGGG - Intergenic
1173021612 20:39272281-39272303 CCGTGTCAGTGGAAAGGGGTGGG - Intergenic
1173093177 20:39995803-39995825 CTGTGTCTGTGTGTAGGGGAGGG - Intergenic
1173356038 20:42291549-42291571 CTGTGCATGTGTAAGGGAGATGG + Intronic
1173531752 20:43775044-43775066 CAGTGGATGTGGAAAGAGGATGG + Intergenic
1174582101 20:51579378-51579400 CTGGGCCCAGGGAAAGGGGAAGG + Intergenic
1174831800 20:53820344-53820366 CTCTGCCTTTGGAAAGGAGAGGG - Intergenic
1174938603 20:54898773-54898795 CTTAGCCTGTGGAAAGGGAAAGG + Intergenic
1176152001 20:63596191-63596213 CTGTGCCTTTAGAAGGAGGAAGG - Intronic
1176236854 20:64057448-64057470 GTGTGCCTGCGCACAGGGGAGGG + Intronic
1176243682 20:64086867-64086889 GTGAGCCTGTGGAAGGAGGAGGG + Intronic
1176876682 21:14136476-14136498 CCCTGTCTTTGGAAAGGGGAGGG + Intronic
1177212896 21:18091860-18091882 CTCTGCCTGTGGAAAGGGGAAGG + Intronic
1177241804 21:18467695-18467717 GTGTGTCTGTGTAAAGAGGAAGG + Intronic
1177456374 21:21344536-21344558 CTCTGCCTTTGGAAATGGGAGGG + Intronic
1177487945 21:21783269-21783291 CTCTGCCTGTGGAAAGGGGAGGG - Intergenic
1177513061 21:22115072-22115094 CCCAGCCTGTGGAAAGAGGATGG + Intergenic
1177578004 21:22983167-22983189 CTCTGCCTTTGGGAAGGAGAAGG + Intergenic
1177740568 21:25148414-25148436 CTCTGCCTATGGAAAGGAGACGG - Intergenic
1177761426 21:25406695-25406717 CTCTGCCTTTGGAAAGGGGAGGG - Intergenic
1177771366 21:25519627-25519649 CTCTGCTTGTGGAAAGGGAAGGG + Intergenic
1178007294 21:28235430-28235452 CTCTGTCTTTGAAAAGGGGAAGG + Intergenic
1178626522 21:34223148-34223170 CTGGGCATTTGGAAATGGGAAGG + Intergenic
1178879882 21:36441020-36441042 CTGGGCCTGTGGGAGGGTGAGGG - Intergenic
1179110148 21:38439159-38439181 CATCGCCTGTGGAAAGGGGAAGG + Intronic
1179459339 21:41523253-41523275 CTCTGCCTGTGGCATGGGGCAGG + Intronic
1179645808 21:42775284-42775306 CTGTGCCTGAGGAAAGCGGGGGG + Exonic
1180558471 22:16596640-16596662 CTGGCCTCGTGGAAAGGGGAAGG + Intergenic
1180616450 22:17131461-17131483 CTGTCTCTTTGGAGAGGGGAGGG - Intronic
1181998757 22:26903454-26903476 CTGGGCCGGTGTAAAGGGGACGG + Intergenic
1182063701 22:27415890-27415912 GTGTGCATGTGAAAAGGGGAAGG - Intergenic
1182472733 22:30558520-30558542 CTGTGCCTTCTGAAAGGTGAAGG - Intronic
1182477528 22:30584338-30584360 GTGTGCCTGTCGGGAGGGGACGG - Intronic
1183006711 22:34909119-34909141 TTGTCCTTGTGAAAAGGGGAAGG - Intergenic
1183201523 22:36388136-36388158 ATTGGCCTGTGGAAAGGGGGTGG + Intergenic
1183388330 22:37527987-37528009 CGGGGCATGAGGAAAGGGGAGGG - Intergenic
1183497262 22:38154004-38154026 CTCTGCTTGTGGAAAGGGGAGGG + Intronic
1184031194 22:41895834-41895856 AGGGGCCTGTTGAAAGGGGATGG + Intronic
1184287472 22:43479622-43479644 CTGTGGCCCTGTAAAGGGGAAGG - Intronic
1184520516 22:44991328-44991350 CTGGGTCCGTGCAAAGGGGAAGG + Intronic
1184846680 22:47092110-47092132 CTGTTCTTGTGGAAAGAGCAGGG - Intronic
1185210451 22:49567976-49567998 CTGTGGCCGTGGAAAGCTGAAGG + Intronic
1185280312 22:49967038-49967060 CTCTGTCTGCAGAAAGGGGAAGG + Intergenic
1185320897 22:50199911-50199933 CAGGGCCTGGGGAATGGGGAGGG + Intergenic
949315887 3:2754566-2754588 CTGAGCATGTGTTAAGGGGAAGG + Intronic
949829200 3:8196553-8196575 CTCTGCTTATGGAAAGGGAAGGG - Intergenic
949871658 3:8594589-8594611 CCATGCCTGTGGTAAGGGGCAGG - Intergenic
950479505 3:13235776-13235798 CAGTGCCTGCAGAGAGGGGAGGG + Intergenic
950695581 3:14699008-14699030 CTCTGCCTGTGGAAGAGGGAGGG - Intronic
950801024 3:15551981-15552003 CTCTTCTTGTGGAAATGGGAGGG - Intergenic
951032180 3:17895144-17895166 CTTTGCCTATGGAAAGGGGAGGG - Intronic
951102370 3:18703660-18703682 CTCTGCCTTTGGAAAGTGGAGGG + Intergenic
951172092 3:19554470-19554492 CTCTGCCTGTGGAAAGGAGAGGG - Intergenic
951181981 3:19669303-19669325 CTCTGCCTATGGAGAGGGCAAGG + Intergenic
951279491 3:20731283-20731305 TTGTTCCTGTGGAAAAGTGAAGG - Intergenic
951310228 3:21116752-21116774 CTCTGCCTCTGGAAAGGGGAGGG - Intergenic
951423176 3:22511167-22511189 CCCTGCCTATGGAAAGGAGAGGG + Intergenic
951435406 3:22657121-22657143 CTCTTCCTTTGGAAAGGGGAGGG - Intergenic
951494854 3:23315189-23315211 CTCTGCCTGGGGAAAGGGGAGGG - Intronic
951494991 3:23316349-23316371 CTCTGCCTGGGGTAAGGGGAAGG - Intronic
952203080 3:31151373-31151395 CTCTGTCTTTGGAAAGGGGAGGG - Intergenic
952222017 3:31332508-31332530 CTTTGCCTTTGGAAATTGGAGGG + Intergenic
952725799 3:36582861-36582883 CTCTGCCTATGGAAAAGGAAGGG + Intergenic
952912658 3:38204071-38204093 CTCTACTTGTGGAAAGGGGGGGG - Intronic
953217279 3:40931092-40931114 CTCTGCCTTTGGAAAGGGGAAGG + Intergenic
953229318 3:41050591-41050613 CTTTGACTGTGGAAATGGGAGGG - Intergenic
953309468 3:41863188-41863210 CTCTCCCTTTGGAAAGGGGAAGG - Intronic
953362349 3:42309231-42309253 CTCTGCCTGTGGAAATGGGAGGG - Intergenic
953498683 3:43411945-43411967 CTGTGCCTGTGGATAGGATAGGG + Intronic
953589128 3:44234744-44234766 CTGTGACCCTGGAAAAGGGAAGG + Intergenic
953996668 3:47524982-47525004 TTTTGCCTGGGTAAAGGGGAAGG + Intergenic
954491654 3:50912677-50912699 CTCTGCCTTTGGAAAAGGGAGGG - Intronic
955585184 3:60470448-60470470 CTCTGCTTGAGGAAAGGAGAGGG - Intronic
956223035 3:66923957-66923979 CTCTGCCCGTGGAAAGGGGAGGG + Intergenic
956997273 3:74841905-74841927 TTGCGCCTGGGGAAAGAGGAGGG - Intergenic
957041393 3:75338164-75338186 CGGTGAGTGTGGACAGGGGAGGG + Intergenic
957621960 3:82604959-82604981 CTCTGCCTTTGGAAAGGGGAAGG + Intergenic
957810400 3:85214690-85214712 CTCTGCTTGAGGAAAGGTGAGGG - Intronic
957965898 3:87322038-87322060 CTTTCCCTGGGGAAAGGGGAAGG + Intergenic
958141188 3:89564494-89564516 TTTTGCCTTTGGAAAAGGGAGGG + Intergenic
958617673 3:96515689-96515711 CTCTGCCTGTGAAAAGGGGAGGG + Intergenic
958631150 3:96685536-96685558 CTCTGCCTTTGGAAAAAGGAGGG - Intergenic
958632230 3:96699524-96699546 CTCTGCCTATGGAAAGAGGAGGG - Intergenic
958669079 3:97180127-97180149 CTCTGCCTTTGAAAAGGGGAGGG - Intronic
958756838 3:98259880-98259902 CTCTGCCTTTGGAAAGGGGAGGG - Intergenic
958876741 3:99625111-99625133 CTCTGCCTTTAGAAAGGGGAGGG + Intergenic
959189812 3:103097205-103097227 CATTGCCTGTGGAAAGGGGAGGG - Intergenic
959303964 3:104636113-104636135 CTCTGCCTTTGGAAAGGGGACGG + Intergenic
959336137 3:105067063-105067085 CTCTGCCTGTGGAAAGAGGAAGG + Intergenic
959474413 3:106791249-106791271 CCCTGCCTATGAAAAGGGGAGGG + Intergenic
959547386 3:107612981-107613003 CTCTGCCTGGGGAAAGGGGAGGG - Intronic
959724966 3:109532973-109532995 CTCTGCCTTTGGAAAGGGGAAGG - Intergenic
959761943 3:109976585-109976607 CTCTGCCTTTGGAAAGGAGGGGG - Intergenic
959798075 3:110456876-110456898 CTCTGTCTTTGGAAAGGGGAAGG - Intergenic
959913665 3:111793269-111793291 CCCTGCTTGAGGAAAGGGGAGGG - Intronic
960067378 3:113387954-113387976 CTCTGCTTGTGGAAAAGGGAGGG + Intronic
960153476 3:114274733-114274755 CTCTGCTTGCAGAAAGGGGAAGG - Intergenic
960312691 3:116135838-116135860 CTGAGCCTGTGGAACAAGGAAGG - Intronic
960526024 3:118711116-118711138 CTTTGCCTCTAGAAAGGAGAAGG + Intergenic
960564974 3:119123256-119123278 CTTTGCCTGTGTAAAGAGGAGGG + Intronic
960722943 3:120642409-120642431 CTGGGCATGTGGAATGAGGAGGG + Intronic
960870082 3:122239325-122239347 CTCTGCCTGTGGAAAGGTGAGGG + Intronic
961109772 3:124274082-124274104 ATGTGCCTTTGGAAAATGGAAGG + Intronic
961604381 3:128082885-128082907 CTCTGCCTGGGGACAGGGGACGG - Intronic
961634620 3:128325188-128325210 TTGTTCCTGGGGAAGGGGGAAGG + Intronic
961662172 3:128475275-128475297 CTGTCCCTGTGTCAAGCGGATGG + Intergenic
961952361 3:130762885-130762907 CTTTGCCTATGGAAAGGGAAGGG + Intergenic
961964372 3:130887565-130887587 CTCTGCCTGTGGAAAGGGGAGGG - Intronic
962038724 3:131682872-131682894 CTCTGCTTGTGGAAAGGGGAGGG - Intronic
962418912 3:135210005-135210027 CTGTGCCTCTGGATGGGTGATGG + Intronic
962453847 3:135547200-135547222 CTGTGGCTCTGGCAAGGGAAGGG - Intergenic
962688429 3:137869195-137869217 CTTTGCCTTTGGGAAAGGGAAGG + Intergenic
962698953 3:137978674-137978696 CTCTGCCTTTGGAAAGGGAAGGG - Intergenic
962712232 3:138097711-138097733 CTGGGACTGTGGAAAGGGCTGGG - Intronic
962759065 3:138492422-138492444 CTCTGCCAGAGGAAAGGGGAAGG - Intergenic
962767641 3:138580117-138580139 CTCTGCCTGGGGAAAGGGGAGGG + Intronic
963020412 3:140868394-140868416 CTCTGCTTATGGAAAGGGGAGGG - Intergenic
963304138 3:143631666-143631688 TTGTGCCTGGGTTAAGGGGAGGG + Intronic
963310147 3:143700574-143700596 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
963365087 3:144323993-144324015 CTCTACCTTTGGAGAGGGGAGGG + Intergenic
963448103 3:145440410-145440432 CTCTGCCTTTGGAAAGGGGAGGG + Intergenic
963515366 3:146301589-146301611 CTCTGCCTTTGGAAAAGGAAGGG + Intergenic
963591844 3:147270142-147270164 CTCTCCCTTTCGAAAGGGGAAGG + Intergenic
963763298 3:149307580-149307602 CTCTGCCTGTAGAAAGAGGAAGG - Intergenic
964036542 3:152206096-152206118 CTGGGCCTGGGGGAAGAGGAGGG - Intergenic
964059543 3:152505090-152505112 CTCTGCCTTCGGAAAGGGGAAGG - Intergenic
964318179 3:155465891-155465913 CTCTGCCTTTGGAAAAAGGAGGG + Intronic
964339043 3:155688805-155688827 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
964349870 3:155791737-155791759 TTCTGCTTGTGGAAAGGGGAGGG + Intronic
964379089 3:156079305-156079327 CTCTGCTTCTGGAAAGGGGAGGG - Intronic
964398382 3:156272444-156272466 GTCTGCCTGGGGAAAGGGGAGGG - Intronic
964525230 3:157610094-157610116 CTGTGGCTGTGCAAAGGGAAGGG + Intronic
964804143 3:160588092-160588114 CTCTGCCTATGGAAAGCAGAGGG + Intergenic
964810153 3:160654517-160654539 CTCTTTCTGTGGAAAGGGGAGGG + Intergenic
964952724 3:162316806-162316828 CTCTGCCTTTAGAAAGTGGAGGG - Intergenic
964961106 3:162427742-162427764 CTGTGCCTATGGAAAGGAGATGG + Intergenic
965118273 3:164519835-164519857 CTTTGCCTTTGGAAAGCGAAGGG - Intergenic
965236830 3:166135924-166135946 ATCTGCCTGTGGAAAGGGGAAGG - Intergenic
965253218 3:166369077-166369099 CTCTGCCTGTGGAAAGGGAAGGG + Intergenic
965349914 3:167599320-167599342 CTCTGCCTGTGAAAATGGGAGGG - Intronic
965866976 3:173216543-173216565 CTCTGTCTGTGGAAAGAGCAAGG - Intergenic
966142004 3:176767359-176767381 CTCTGCTTGTGGAAAGAGGAGGG + Intergenic
966281258 3:178232324-178232346 CTGTGGCTGTGAGCAGGGGAAGG + Intergenic
966312985 3:178615508-178615530 CTTTGCCTTTGGAAAGGGGAGGG - Intronic
966348618 3:179005257-179005279 CTCTGCCTTTGAAAACGGGAGGG + Intergenic
966400990 3:179546732-179546754 CTCCACCTGGGGAAAGGGGAGGG + Intergenic
966452119 3:180074328-180074350 CTCTGCCTTTGGAAAGGGGAGGG + Intergenic
968004931 3:195236331-195236353 CTCTGCCTGGAGAAAGAGGAGGG - Intronic
968913889 4:3488839-3488861 CTGTGGATGTGGAAGGGGCAGGG + Intronic
969350347 4:6594716-6594738 CTGTACCTGTGGAATAGGGCAGG - Exonic
969397695 4:6933309-6933331 CTCTGCCTCTAGAAAAGGGAAGG - Intronic
969438427 4:7201925-7201947 CTGTAGCTTTGGAAAGGTGAAGG + Intronic
969451867 4:7278495-7278517 CTGGACCTGTGGGAAAGGGAGGG - Intronic
969466893 4:7362643-7362665 CTTTGCCTGTGGCAGGGTGAGGG + Intronic
969583386 4:8078326-8078348 GTGTGCGTGGGGAGAGGGGATGG - Intronic
969584629 4:8084725-8084747 CTTGGCCTGGGGAAAAGGGATGG - Intronic
969846756 4:9925437-9925459 GTGTTACTGTGGAAAGGGGTGGG + Intronic
970071164 4:12161781-12161803 CTCTGCCTTTGGAAAGGGGAGGG - Intergenic
970667421 4:18353807-18353829 CTTTGCTTTTGGAAAGGAGAGGG - Intergenic
971095613 4:23399070-23399092 CTCTGCCTGTGGAAAGGGGACGG - Intergenic
971105220 4:23517355-23517377 TTCTGCCTGTGGAAAGGAGAAGG - Intergenic
971838646 4:31802887-31802909 CTCTGACTGTGTAAAGGGAAGGG - Intergenic
971914459 4:32850581-32850603 CTCTGACTGTGGAAAGGGGAGGG - Intergenic
972009503 4:34158922-34158944 CTTTGCCTGCGGAAAAGTGATGG + Intergenic
972207837 4:36799074-36799096 CTCTGCCTGTGGAAAGGGAGAGG + Intergenic
972272165 4:37522314-37522336 CTCTGCCTTTGGAAAGGTGAGGG - Intronic
972278385 4:37580973-37580995 CTTTGCCTGGGAAAAGGGGAGGG - Intronic
972579309 4:40380555-40380577 CTCTGCTTGAGGAAAGGGAAGGG + Intergenic
972904513 4:43728425-43728447 CTGTGCCTATGCAAAGGGGAGGG + Intergenic
972977821 4:44659159-44659181 CTGTGGCTCTGTAAAAGGGAAGG - Intronic
973053971 4:45630875-45630897 TTCTGCCTATGGAAAGGGGAAGG + Intergenic
973327385 4:48877550-48877572 CTCTCCCTGTGGAAATGGGAGGG - Intergenic
973852839 4:54977840-54977862 CTCTGCCTGTGAAAAGGGAAGGG + Intergenic
974290383 4:59921678-59921700 CTCTGCCTTTGGAAAGGAAAGGG + Intergenic
974301075 4:60067668-60067690 CTCTGCTTGTGGAAAGGGGAGGG + Intergenic
974333204 4:60506006-60506028 CTCTGCCTGTGGTTAGGGGAGGG + Intergenic
974469709 4:62302683-62302705 GTCTGCCGCTGGAAAGGGGAGGG + Intergenic
974630288 4:64479880-64479902 CTCTGCCCTTGGAAAGGGGAGGG - Intergenic
974893198 4:67907050-67907072 CTCTGCCTTTGGAAAAGGGAAGG - Intergenic
975081046 4:70280903-70280925 CTGTGCCTATGGAAAGAGGAAGG + Intergenic
975252762 4:72198463-72198485 CTCTGCCTTTGGAAAGAGAAGGG + Intergenic
975313078 4:72925231-72925253 AGGTGCCTGTGTAAAGGGGAGGG - Intergenic
975369442 4:73567983-73568005 CTTTGCCTGTGGAAAGGGGAGGG - Intergenic
975375900 4:73645716-73645738 CTTGGCCTGTGGCAAGTGGAGGG - Intergenic
975502215 4:75099756-75099778 CTCTGCCTTTGTAAAGTGGAGGG - Intergenic
975592721 4:76016809-76016831 CTCTGCCTCTGGAAAGGGGAGGG - Intronic
976016474 4:80560722-80560744 CTCTGCCTTTGGAAAAGAGAGGG + Intronic
976041152 4:80886114-80886136 CTCTGCCTGTGGAAATGGGAAGG + Intronic
976082769 4:81375115-81375137 CTCTGCCTATGAAAAAGGGAGGG - Intergenic
976451807 4:85199365-85199387 CTCTGCCTTTGGAAAGGGGAGGG - Intergenic
976470568 4:85423978-85424000 CTGTGTGTGTGGAAGGGGGGCGG + Intergenic
976722107 4:88178806-88178828 CTCTGCTTGTGGAAATGAGAGGG + Intronic
976982122 4:91244173-91244195 CTATGCCTGTGGAAAGGGGAAGG + Intronic
977337525 4:95717486-95717508 AGGTGCCTGTGGAAAAGGGTAGG + Intergenic
977399342 4:96511395-96511417 CTATGCCTTTGGAAAGGGGAGGG + Intergenic
978030976 4:103939470-103939492 CTCTGCCTTTGGAAAGAGGAAGG + Intergenic
978116538 4:105025556-105025578 CTCTGCCTTTTGAAAGGGAAGGG + Intergenic
978197735 4:105990587-105990609 CTTTGCCCCTGGAAGGGGGAGGG + Intronic
978520460 4:109610009-109610031 CTCTGCTTGTGGAAAGGGGAGGG - Intronic
978804051 4:112782218-112782240 ATGTGTTTCTGGAAAGGGGATGG + Intergenic
979100202 4:116603543-116603565 CTCTGCCTTTGGAAAGGAGAGGG - Intergenic
979213228 4:118132300-118132322 TTCTCCCTGTGGAAAGGGGAAGG - Intronic
979219073 4:118200286-118200308 CGCTGCATTTGGAAAGGGGAGGG - Intronic
979395094 4:120178160-120178182 CTCTGTTTGTGGAAAGGGGAGGG + Intergenic
979573050 4:122252561-122252583 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
979746360 4:124218369-124218391 CTCAGCCTGTGGCAATGGGATGG - Intergenic
980442564 4:132867646-132867668 CTCTGACTGTGGAAAGGGTAGGG + Intergenic
980443013 4:132871597-132871619 CCCTGCCTTTGGAAAGGGGAGGG + Intergenic
980686892 4:136240595-136240617 CTCTGCCTTTGGAAAGGGGAGGG + Intergenic
980693068 4:136320706-136320728 CTCTGCTTGTGGAAAGGGGAGGG + Intergenic
980723484 4:136727522-136727544 CTCTGCCTTTGGAAAATGGAGGG - Intergenic
980960500 4:139470286-139470308 CTCTGTCTTTGGAAATGGGAGGG - Intronic
981298056 4:143156006-143156028 ATCTGCCTTTAGAAAGGGGAGGG - Intergenic
981530749 4:145751875-145751897 CCCTGCCTGTGCAAAGGGAAAGG - Intronic
981870992 4:149486375-149486397 CTCTGCCTGTGGAAACTGGAGGG - Intergenic
981895704 4:149796321-149796343 CTCTCCCTTCGGAAAGGGGAAGG + Intergenic
982683319 4:158458903-158458925 CTCTGTCTTTGGAAAGTGGAGGG - Intronic
982719803 4:158847907-158847929 CTCTGCCTGGGGACAGGAGAGGG + Intronic
982899473 4:160980549-160980571 CTCTTCCTGTGGAAAGGGGAGGG - Intergenic
983165906 4:164477298-164477320 CTCTGTCTGTGGAAAAAGGAGGG - Intergenic
983338018 4:166420979-166421001 CTCTGCTTGTGGAAAGGGGAGGG - Intergenic
983832018 4:172339388-172339410 CTAGACCTGTGGCAAGGGGAGGG + Intronic
984529644 4:180901272-180901294 CTCTCCCTATGGAAAGGAGAGGG - Intergenic
984594643 4:181653854-181653876 CTGGGTCGGGGGAAAGGGGAGGG - Intergenic
985229541 4:187799654-187799676 CTCTACCTGTGCTAAGGGGAAGG + Intergenic
985620383 5:951993-952015 CGGGGCCTGTGGGAAGGGGCTGG - Intergenic
985708459 5:1414895-1414917 CTGTGTCTGGGGAAGGGGGCGGG + Intronic
985851893 5:2394595-2394617 CAGTTCCTCTGGAAAGAGGATGG - Intergenic
986244790 5:5997588-5997610 GTGTGCCTGTGGCAGGGTGATGG + Intergenic
986492779 5:8308833-8308855 CTCTGACTTTGGAAATGGGAAGG + Intergenic
986544391 5:8879842-8879864 CTCTGCCTCTGGAAGGGGGAAGG - Intergenic
986725742 5:10595098-10595120 CTGTGACTGTGGAGGGTGGAGGG + Intronic
986756376 5:10840130-10840152 CTCTGCCTTTGGAAAGTGGAGGG + Intergenic
986899301 5:12412649-12412671 CTCTGCTTTTGGAAAGGGAACGG - Intergenic
987164021 5:15174604-15174626 CTCTTCCTGTGGAAATGGGAGGG + Intergenic
987496524 5:18652549-18652571 TTTTGCCTGTGGAAAGGGGAGGG - Intergenic
988071439 5:26293771-26293793 CTGTGCCTGTGAGAATAGGAAGG - Intergenic
988117900 5:26920275-26920297 TTCTGCTTGAGGAAAGGGGAGGG + Intronic
988340174 5:29960537-29960559 CTCTGCCTGTGGAAAGGGGAAGG + Intergenic
989427864 5:41316765-41316787 CTGTACCTTTGGAAAGGACAGGG + Intronic
989471401 5:41823283-41823305 TTGTGCTTCTGGCAAGGGGAGGG - Intronic
989504781 5:42215236-42215258 CTCTGCCTTTGGAAAGTGGAGGG - Intergenic
989568708 5:42925471-42925493 CTGTGACAGTGGTCAGGGGAAGG - Intergenic
989629024 5:43461696-43461718 CTCTGTCTTTGAAAAGGGGAGGG + Intronic
989671665 5:43924724-43924746 CTTTACCTTTGGAAAGGAGAGGG - Intergenic
990059628 5:51631127-51631149 CTTTGCCTGTTGCAAGGAGAAGG + Intergenic
990774266 5:59287322-59287344 CTCTGCTTGTGGAAAGGAGAAGG + Intronic
990900005 5:60739575-60739597 CTCTGCTTATGGAAAGGGCAGGG + Intergenic
991180539 5:63746510-63746532 CTCTGCCTTTGGAAAGGGGAGGG - Intergenic
991237813 5:64419298-64419320 CTCTACCTGTGGAAAGGGGACGG + Intergenic
991395246 5:66198268-66198290 CTCTGCCTGGGGAAAGGAGAGGG - Intergenic
991639833 5:68741167-68741189 CTCTCCCTGTGGAGAGGCGAAGG + Intergenic
991663689 5:68974842-68974864 CTCTGACTTTGGAAAGGGGAGGG + Intergenic
992291374 5:75283374-75283396 TTCTGCTTGAGGAAAGGGGAGGG + Intergenic
992546240 5:77816682-77816704 CTGTGCCTGTGTTGCGGGGAGGG + Intronic
992692664 5:79256165-79256187 CTCTGCCACTGGGAAGGGGAGGG - Intronic
992744063 5:79801962-79801984 CTGACTCTGTGGCAAGGGGACGG + Intergenic
992894716 5:81236006-81236028 CTGTGCCAGTGTGAAGAGGAAGG - Intronic
993192185 5:84696570-84696592 CTCTGCCCTTGAAAAGGGGAGGG + Intergenic
993207001 5:84894952-84894974 TTCTGCCTGTGGAAAGGAGAGGG - Intergenic
993278813 5:85898410-85898432 CTCTGCCTTTGGAAAGCAGATGG - Intergenic
993287298 5:86016092-86016114 CTCTTCCTGTGGAAAGGGGAGGG - Intergenic
993582357 5:89677998-89678020 CTCTGACTTTGGAAAGGGCAGGG + Intergenic
993932147 5:93953864-93953886 TGCTGCTTGTGGAAAGGGGAGGG - Intronic
993981315 5:94546126-94546148 CTCTGCCTGTGGAAAGGGGAAGG + Intronic
994028620 5:95114562-95114584 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
994217800 5:97158847-97158869 CTTTGCTTGTGGAAAAGGGAGGG - Intronic
994226239 5:97254363-97254385 CTTTATCTGTGGAAAAGGGAGGG + Intergenic
994274653 5:97821780-97821802 TTCTACCTGTGGAAAGGGAAGGG - Intergenic
994477571 5:100290449-100290471 CTCTGCCTTTGGAAAGAGGAGGG - Intergenic
994530016 5:100957106-100957128 CTCTGCTTTTGGAAAGGGGAGGG + Intergenic
994633885 5:102320446-102320468 CTTTGCCTTTGGAAAAAGGAGGG - Intergenic
995278522 5:110307012-110307034 CTCTGCCATTAGAAAGGGGAGGG - Intronic
995374774 5:111461703-111461725 CTGTGCCTCTGGGAAGGAGGAGG - Intronic
995573099 5:113502600-113502622 CTCTGCTTGAGGAAAGGGGAGGG - Intergenic
995770665 5:115665627-115665649 CTCTACCTGTGGAAAGGGAAGGG + Intergenic
996594540 5:125185626-125185648 TTTTGCCTTTGGAAAGGGGAGGG + Intergenic
996666619 5:126066989-126067011 CTCTGCCTGTGGAAAGAGGAAGG + Intergenic
996931600 5:128896002-128896024 CTTTGCCTGTAGAAAGAGGAGGG - Intronic
996968342 5:129331866-129331888 CTCTGCATTTGGAAAGGGGAGGG + Intergenic
997104762 5:131005960-131005982 CTCTGGTTATGGAAAGGGGAGGG + Intergenic
997371287 5:133362631-133362653 GTGTGCCTGTGCACATGGGAAGG + Intronic
997384226 5:133459852-133459874 CTTTGCCTAGGGAAAGGGGAGGG - Intronic
997832712 5:137164826-137164848 TTCTACCTTTGGAAAGGGGAGGG + Intronic
998291140 5:140916028-140916050 CTCTGCCTGTGGAAAGGGGAGGG - Intronic
998372142 5:141668795-141668817 CTTGGCCTTTGGAAATGGGAAGG + Intronic
998480372 5:142458289-142458311 CTGTGACAGTGGAAAGGGGAGGG - Intergenic
998634059 5:143932551-143932573 CTCTGCCTGTGTAAAGGGAAAGG + Intergenic
998695265 5:144631055-144631077 CTTTGCCTTTGGAAAGGGGAGGG + Intergenic
999257186 5:150216239-150216261 TTGTGACTGTGGAAACGGGGTGG + Intronic
999270649 5:150294707-150294729 CTGTGCTTGTGGGGAGGGAAGGG - Intergenic
999345700 5:150817184-150817206 CTCTTCCTTTGGAAAGGGGAGGG + Intergenic
999406529 5:151312090-151312112 CCCTACCTTTGGAAAGGGGAGGG - Intergenic
999919459 5:156303212-156303234 CTCTGCTTATGGAAAAGGGAGGG - Intronic
999977788 5:156929170-156929192 CCATGCCAGTGGCAAGGGGATGG + Intronic
1000270279 5:159677442-159677464 CTCTGCCTTTGGAAAGAGGAGGG + Intergenic
1000289919 5:159860712-159860734 CTGTGTCTGTAGATAGTGGAAGG - Intergenic
1000599566 5:163255429-163255451 CTGTGCCTGTGTTATGGTGATGG - Intergenic
1000651270 5:163821869-163821891 CTCAGCCTTTGGAAAGGGGAGGG - Intergenic
1001177714 5:169487174-169487196 CTCAGGCTTTGGAAAGGGGAGGG + Intergenic
1001288453 5:170439928-170439950 CTCAGCCTGTGGCACGGGGATGG - Intronic
1001776369 5:174331958-174331980 CTGACCCTGTGGAAGGGAGAGGG + Intergenic
1001797146 5:174511859-174511881 CTGTTGCTGTGGAATGGGCATGG + Intergenic
1001831589 5:174793795-174793817 CCGGGCCTGCGGGAAGGGGAGGG - Intergenic
1002254319 5:177948058-177948080 AGGTGCCTGTGGAAAGCAGATGG - Intergenic
1002300643 5:178255703-178255725 CTGTGACTGGGGACGGGGGAGGG - Intronic
1002719612 5:181250201-181250223 CAGAGGCTGTGGAAAGGGGATGG + Intergenic
1003099242 6:3164478-3164500 CAGCGAATGTGGAAAGGGGAAGG + Intergenic
1003629877 6:7777190-7777212 CTGTGCATGTGGTGAGGGGAAGG + Intronic
1003710867 6:8588331-8588353 CAGTCCCTGTTGAGAGGGGATGG + Intergenic
1003975538 6:11340054-11340076 CAGAGACTGTGGAAAGGGAAGGG - Intronic
1004071717 6:12304509-12304531 CTCTGCCTGGGGACAGGGAAGGG + Intergenic
1004282733 6:14294659-14294681 CTGTGCCTGTGGGAAGTAGAGGG - Intergenic
1004437926 6:15614873-15614895 CTCAGGCTGTGGAAAGGGGCTGG - Intronic
1004899557 6:20181703-20181725 CTGTGGGTGTCCAAAGGGGAGGG + Intronic
1005037350 6:21569289-21569311 CTTTGCTTGAGGAAAGGGGAGGG - Intergenic
1005157004 6:22818969-22818991 TTCTGCCTATGGAAAGGGGAGGG - Intergenic
1005364138 6:25060505-25060527 GTGTGTGTGTGGAAAGGGGAGGG + Intergenic
1005504415 6:26457544-26457566 CTCTGGCTTTGGAAAGGGGGCGG + Intergenic
1006018523 6:31102782-31102804 CTCTGCCTAAGGAAAGGGGAGGG - Intergenic
1006189084 6:32196672-32196694 CAGTGTCTGTGGAAAGGGGGGGG - Intronic
1006462886 6:34173761-34173783 CTGTGCCTGCGGAAAGGGGAGGG - Intergenic
1006581495 6:35080184-35080206 CTGTGCCTGGGGACAGGGAGGGG + Intronic
1006581865 6:35081981-35082003 CTGTGCTTGTAGAAAGGGAAAGG - Intronic
1006963783 6:37961262-37961284 CTCTGCCTTTGGAAAGGGGAGGG + Intronic
1007591667 6:43024968-43024990 ATGTGCCTGTGGAAGTGGGGAGG - Exonic
1007731162 6:43947927-43947949 CTGTGCCTGTGGGATGGGAGAGG - Intergenic
1008017915 6:46541916-46541938 CTCTACCTTTGGAAAAGGGAGGG + Intergenic
1008250302 6:49231812-49231834 CTATGCCTCTGGAAATGGGAGGG - Intergenic
1008314754 6:50026147-50026169 CTCTGACTGTTGAAAGGGGAGGG + Intergenic
1008707497 6:54181243-54181265 TTTTGCCTGTGGAAAGGGGAGGG - Intronic
1008727535 6:54441004-54441026 CTCTGCCTTTGGAAAGGGTGGGG - Intergenic
1008731730 6:54491256-54491278 CTCTGCCTGGGGAAAAGGAAGGG - Intergenic
1008822485 6:55650774-55650796 CTCTGCCTATGGAAATGGGAGGG - Intergenic
1008868236 6:56241018-56241040 GGGTGCCTATGGAATGGGGAGGG - Intronic
1008940576 6:57041250-57041272 CTCTGCCTGGGTAAAAGGGAGGG + Intergenic
1009371223 6:62905636-62905658 CTCTGCCTATAGAAAAGGGAAGG + Intergenic
1009437653 6:63636201-63636223 CTGTGCGTGTGGAAGGGGATGGG - Intronic
1009687748 6:66986229-66986251 CTCTGCCTTTGGGAAGGGGAGGG - Intergenic
1009771178 6:68144815-68144837 CTCTGCCTTTGGAATGGGGAGGG - Intergenic
1009823842 6:68840580-68840602 CTCTGCTTTTGGAAATGGGAGGG + Intronic
1009893841 6:69721968-69721990 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
1010095955 6:72046280-72046302 GTGTGTGTGTGGAAAGGGGTTGG + Intronic
1010264697 6:73853006-73853028 CTATGCCTGTGGAAAGGGGAAGG - Intergenic
1010324537 6:74549894-74549916 CTCTGCCATTGGAAAGGGGTAGG - Intergenic
1010325116 6:74555135-74555157 CTCTACCTTTGGAAAGGGGAGGG + Intergenic
1010414901 6:75601935-75601957 CTGTCCATGTGGACAGGGGTGGG - Intronic
1010474840 6:76274653-76274675 CGCTGCCTGAGGAAAGGGGAGGG - Intergenic
1010502252 6:76615318-76615340 CTCTGCCTGTGGAAAGGGGAGGG + Intergenic
1010528949 6:76942508-76942530 CTCTGCCTTTGGAAAGGGGTGGG + Intergenic
1010560227 6:77340423-77340445 CTCTGCCTGTGGAAAGGGAAGGG - Intergenic
1010676716 6:78753950-78753972 CTCTGCCTGTGGAAAGGGGATGG + Intergenic
1010838875 6:80623666-80623688 CTCTGCCTGTGGAAAGGGATGGG + Intergenic
1011033255 6:82944872-82944894 TTCTGCCTGTGGAAAGGGGAGGG + Intronic
1011236069 6:85218524-85218546 CTCTGTTTGTGGAAAGGAGAGGG + Intergenic
1011359675 6:86510563-86510585 CTTTGTTTGAGGAAAGGGGAGGG - Intergenic
1011403193 6:86987111-86987133 CCATGGCTGTGGAAAGGGGTTGG - Intronic
1011901393 6:92302457-92302479 CTCTGCTTTTGGAAAGGGGAGGG + Intergenic
1012003673 6:93685355-93685377 CTCTGCCTATGGAAAGGGGAGGG + Intergenic
1012091510 6:94903195-94903217 CTCTGCCTTTGAAAAGGGGAGGG + Intergenic
1012195812 6:96340683-96340705 CTGTACCTCTGGGGAGGGGAAGG - Intergenic
1012224552 6:96689053-96689075 CTCTGCCTGTGGAAAGGGGAGGG + Intergenic
1012288043 6:97417331-97417353 CTCTGCCTTTGGAAAGGGGAGGG - Intergenic
1012288352 6:97421497-97421519 CTCTGCCTTTGGAAAGGGGAGGG - Intergenic
1012620503 6:101339138-101339160 CTCTGCCTTTTGAAAGGGGAAGG - Intergenic
1012678996 6:102154407-102154429 CTTTGCCTTTGGAAAGGAGAGGG + Intergenic
1012715305 6:102661096-102661118 CTCTGCCTGTGAAAAGAGGAGGG + Intergenic
1012717740 6:102698679-102698701 TTCTGCTTGTGGAAAGGGGAGGG - Intergenic
1012761675 6:103310156-103310178 TTCTGCCTTTGGAAAGGGGAGGG + Intergenic
1012824175 6:104126417-104126439 CTCTGCATGAGGAAAGGAGAGGG - Intergenic
1012892169 6:104908625-104908647 CTCTGCTTGTGGAAAGGGGAGGG + Intergenic
1013535667 6:111061047-111061069 ATGTGCATGTGGGGAGGGGAGGG - Intergenic
1013687510 6:112601941-112601963 CTCTGCCTGTGGAAAGAGGAGGG + Intergenic
1013908606 6:115246990-115247012 CTCTACTTGTGGAAAGGGGAGGG + Intergenic
1013925571 6:115468027-115468049 CTCCGCCTTTGGAAAGAGGAGGG - Intergenic
1014009667 6:116461653-116461675 CTCTGCCTTTGGAATGGGGTGGG + Intronic
1014051910 6:116964626-116964648 CTGTGTATGTGGAAAGGGTGTGG + Intergenic
1014234684 6:118940694-118940716 CTTTGCCTGTGGAAAGGAGAGGG + Intergenic
1014583094 6:123162210-123162232 CCTTGCCTTTGGAAAGGGAAAGG + Intergenic
1014840746 6:126217985-126218007 CTCTGCTTGTGAAAAGGGGAGGG - Intergenic
1014865194 6:126520994-126521016 CTCTGCCTTTGGAAAGTGGATGG - Intergenic
1015052774 6:128862656-128862678 CTCTGCCTATGGAAAGGGAAGGG - Intergenic
1015133785 6:129844699-129844721 CTATGCCTGGGGAAAGGAGAAGG - Intronic
1015456785 6:133435462-133435484 CTGTGTCTGGGGAAATGGGTTGG + Intronic
1015460763 6:133488147-133488169 TTCTGCTTGTGGAAAGGGTAGGG + Intronic
1015627488 6:135195731-135195753 CTGTGTCTAAGGAAGGGGGAAGG - Exonic
1015959499 6:138632130-138632152 CTCTGCCTTGGGAAAGGGGAGGG + Intronic
1016135269 6:140532819-140532841 CTCTGCCTTTGGAAAGGGGAGGG + Intergenic
1016151262 6:140745532-140745554 CTCTGCCTTTGAAAACGGGAGGG + Intergenic
1016154052 6:140781213-140781235 CTCTGTCTTTGGAAAGGGAAGGG + Intergenic
1016185671 6:141195624-141195646 CTCTGACTTTGAAAAGGGGAGGG - Intergenic
1016567536 6:145472673-145472695 CCCTGCCTTTGAAAAGGGGAAGG + Intergenic
1016798410 6:148143044-148143066 CAGAGGCTGTGGAAATGGGAAGG - Intergenic
1017379706 6:153813989-153814011 CTCTGCCTTTGAAAAGGGGAGGG + Intergenic
1017916919 6:158838182-158838204 CTGTCTCTGTGGAAATGTGACGG + Intergenic
1017924756 6:158901360-158901382 CTCTCCCTGTGGAAAGGGCAGGG - Intronic
1017992193 6:159500680-159500702 CTGAGCCTGTGAGGAGGGGAGGG - Intergenic
1019563408 7:1668678-1668700 CTGGGCCTGTGGAACGAGGCCGG - Intergenic
1019932180 7:4230882-4230904 CACAGCCTGTGGACAGGGGATGG - Intronic
1020519928 7:9173082-9173104 TTCTGCCTTTGGAAAGGGGAAGG - Intergenic
1020624276 7:10558426-10558448 CGCTGGCTGTGGAAAGGGAAAGG + Intergenic
1020812711 7:12865185-12865207 CTCTGCCTGTGGAAAGGGGAGGG + Intergenic
1020907749 7:14085672-14085694 CTGTGCTTCTGGAAGGGAGAAGG - Intergenic
1021034852 7:15785206-15785228 TTCTGCCTGTGGAAAAGGGAGGG + Intergenic
1021046196 7:15925493-15925515 GTCTGCCTTTGGAGAGGGGAGGG + Intergenic
1021214542 7:17900548-17900570 CTCTACTTGTGGAAAGGGGAGGG - Intronic
1021353792 7:19628561-19628583 CTCTGCCTTTGGAAAGGGGAGGG + Intergenic
1021640849 7:22734996-22735018 CTGCTGCTGTGGATAGGGGAGGG - Intergenic
1021641043 7:22736121-22736143 CTCTGCTTCTGAAAAGGGGAGGG + Intergenic
1021842724 7:24733687-24733709 CTCTGCCTGGGGAAAGGAGAGGG + Intronic
1022080259 7:27012956-27012978 CTCCTCCTTTGGAAAGGGGAAGG + Intergenic
1022112509 7:27240170-27240192 ATGCGCCGGTGGAAAGGGGCGGG + Intergenic
1022223532 7:28339871-28339893 CTTTTCCTGAGGAAAGGGGAAGG - Intronic
1022343153 7:29487117-29487139 CTGTGCCTGGAGAACAGGGATGG + Intronic
1022366916 7:29730435-29730457 CTCTGCCTGGGGAAAGGGGAAGG - Intergenic
1022392488 7:29955641-29955663 CTGTGCCTGTTGAAATGGGCAGG - Intronic
1022393652 7:29965462-29965484 CTGTCCCTGTGCATTGGGGATGG + Intronic
1022419493 7:30207096-30207118 CTGTGCCTGGGGAATGTGAAAGG - Intergenic
1023081587 7:36531866-36531888 GTGTGCGTGTGCACAGGGGAGGG + Intronic
1023254211 7:38296776-38296798 ATGTGTCTGTGGAAAGGGATGGG + Intergenic
1024170340 7:46778406-46778428 CTCTGCCTTTGGAAATGGGAGGG + Intergenic
1024410897 7:49039631-49039653 CTATGCCTTTGGAAAGGGAAAGG + Intergenic
1024662371 7:51510772-51510794 CTCTGCCTGTGTAAAGGGGAGGG - Intergenic
1024872322 7:53979847-53979869 CTAAGCTTCTGGAAAGGGGAAGG - Intergenic
1024891730 7:54211270-54211292 CTCTGCCTTTGGAAAGCGGAGGG + Intergenic
1025138033 7:56436890-56436912 TTCTGCCTGTGGAAAGGGGAGGG + Intergenic
1026188801 7:68105631-68105653 CTGTGTGTGTGAGAAGGGGAAGG + Intergenic
1026267795 7:68810475-68810497 CTGAGCCTCTTAAAAGGGGAGGG - Intergenic
1026705008 7:72682977-72682999 TTGTGCTTCTGGTAAGGGGAGGG + Intronic
1026880128 7:73902477-73902499 CTGGCCCTGTGGGACGGGGACGG - Intergenic
1027126967 7:75563349-75563371 CTGTGCCTTTGGGCTGGGGAGGG - Intronic
1027604944 7:80288382-80288404 CTCTGCTTGTGGAAAGGGGAAGG + Intergenic
1027674763 7:81143594-81143616 CTCTGCTTGAGGAAATGGGAGGG + Intergenic
1027996168 7:85427517-85427539 CTCTGTCTGTGGAAAGGGGAAGG + Intergenic
1028001422 7:85502369-85502391 CTCTGCCTTTGGAATGGGGAGGG + Intergenic
1028160986 7:87484176-87484198 TCCTGCCTGTGGAAAGGGGAGGG + Intergenic
1028266520 7:88733247-88733269 CTCTGCTTGTGGAAATGGGAGGG - Intergenic
1028266629 7:88733903-88733925 CTCTGCTTGAGGAAAGGGGGGGG - Intergenic
1028483012 7:91328439-91328461 CTGTGCATGTGTATTGGGGAGGG + Intergenic
1028521948 7:91741996-91742018 CTCTGCCTGTGGAAAGGAGAGGG - Intronic
1029153994 7:98502041-98502063 CAGTGCATTTGGAAGGGGGATGG + Intergenic
1029825348 7:103187020-103187042 CTCTGCCTGGGGAAAGGGGAAGG + Intergenic
1030431543 7:109455283-109455305 TTCTGCTTGTGGAAATGGGAGGG - Intergenic
1030598932 7:111570979-111571001 CTCTGCCTTTGGAAAGGGGAGGG + Intergenic
1031231566 7:119114220-119114242 CTTTGCCTTTGGAAAGGGGAGGG - Intergenic
1031353468 7:120763121-120763143 TTCTGCCTGAGGAAAGGAGAGGG - Intergenic
1031553306 7:123142175-123142197 CACTGCCTTTGGAAAGGGGTGGG - Intronic
1031721991 7:125187734-125187756 TTCTGCTTGAGGAAAGGGGAGGG + Intergenic
1031753866 7:125612978-125613000 CCCTGCTTGAGGAAAGGGGAAGG + Intergenic
1032138732 7:129307341-129307363 CTCTGCCTGGGGAAAGGGTAGGG - Intronic
1032263788 7:130356478-130356500 CTGGGGCTGGGGGAAGGGGATGG - Intronic
1032398611 7:131608326-131608348 CTCTGTCTGTTGAAGGGGGATGG + Intergenic
1032939183 7:136768624-136768646 CTCTGCCTGTGGTAAGGGGAAGG + Intergenic
1033499947 7:141937434-141937456 CTCTGCCTGCAGAAAGGGGAGGG + Intronic
1033540195 7:142349320-142349342 CAGCTCCAGTGGAAAGGGGATGG - Intergenic
1033558207 7:142507469-142507491 CAGCCCCAGTGGAAAGGGGATGG - Intergenic
1033790306 7:144785117-144785139 CTGTCCCAGGGGAATGGGGAAGG + Intronic
1034175879 7:149099395-149099417 CTGTGAATTTGGAAAGGGGAGGG + Intergenic
1034453391 7:151149919-151149941 CCTTGGCTGGGGAAAGGGGAAGG - Intronic
1034618846 7:152441356-152441378 CTGGCCTCGTGGAAAGGGGAAGG - Intergenic
1035084467 7:156246650-156246672 CTCTGCCTTTGGAAAGGGGAGGG - Intergenic
1035309635 7:157957255-157957277 CTGTTGCTGTGGAGAGGGGATGG - Intronic
1035550860 8:523706-523728 CTCTGCTTGTGGAAAGGGGAGGG + Intronic
1035753994 8:2017630-2017652 CTCTGCCTGTGAAAATGGGAGGG - Intergenic
1036089828 8:5653404-5653426 CAGTGTCTGAGGAAAGGAGAGGG + Intergenic
1037295691 8:17397480-17397502 CTCTGCCTGCAGAAAGGAGAGGG + Intronic
1037374938 8:18217441-18217463 CTGTGCCTGGACAAAGGAGAAGG + Intronic
1037656659 8:20889409-20889431 CTGTTACTGTGGGAAGGGCAGGG - Intergenic
1037767266 8:21779943-21779965 TGGTGCCTTTGGGAAGGGGAGGG - Intronic
1037943583 8:22972971-22972993 CTATGCCTGTGCAAAGGCGCAGG - Intronic
1038044147 8:23751986-23752008 GTGTATCTGTGGGAAGGGGAAGG + Intergenic
1038438911 8:27558262-27558284 CTGTCCCTGAGGAAGGGGCAGGG - Intergenic
1038871835 8:31503747-31503769 CTCTGCCTTTGGAAAGAGGAGGG - Intergenic
1039002282 8:32995091-32995113 CTCTGCCTTTAGAAAGGGGAGGG - Intergenic
1039282055 8:35996936-35996958 CTCTGCCTTTGGAAAGAGGAGGG - Intergenic
1039842481 8:41303944-41303966 CTGGGAGTGTGGAAATGGGAAGG - Intronic
1040095756 8:43440721-43440743 TTCTTCCTTTGGAAAGGGGAAGG + Intergenic
1040743084 8:50604522-50604544 CCCTGCCTGTAAAAAGGGGAGGG - Intronic
1040745370 8:50635525-50635547 TTCTGCCTGTGTAAAAGGGAAGG - Intronic
1041579848 8:59446607-59446629 CTCTGCATGTGCAAAGGGGAGGG - Intergenic
1041851866 8:62402155-62402177 CTCTGCATGTGGAAAGTGAAGGG - Intronic
1042162683 8:65912791-65912813 CTCTGCCTATGGAAAGGGGAGGG + Intergenic
1042297998 8:67242926-67242948 TTCTGCCTGTGAAAAGGGGAGGG + Intronic
1042392409 8:68251043-68251065 CAGGGGCTGTGGGAAGGGGATGG + Intergenic
1042726820 8:71888126-71888148 CTCTGCTTTTGGAAAGAGGAAGG - Intronic
1042898431 8:73695778-73695800 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
1043042117 8:75276326-75276348 CTCTGCTTGAGGAAAGGGGAGGG + Intergenic
1043080140 8:75755890-75755912 CTCTGCCTGAGGAAAGGGGAGGG + Intergenic
1043214988 8:77574394-77574416 CTCTGCTTGTGAAAATGGGAAGG + Intergenic
1043227055 8:77746095-77746117 TTCTGCCTGAGGAAAGGAGAGGG + Intergenic
1043366899 8:79543281-79543303 CTCTGCCTTTGGAAAGGGGAAGG + Intergenic
1043627045 8:82274093-82274115 CTGTGCCTTTGGAAAGGGGAGGG + Intergenic
1043739857 8:83797361-83797383 TTCTGCCTGTGAAAAGGGGAGGG - Intergenic
1043740148 8:83801277-83801299 TTCTGCCTGTGAAAAGGGGAAGG - Intergenic
1043750606 8:83929276-83929298 CTTTGCCTGCGGAAAGGGAAAGG - Intergenic
1043998067 8:86843454-86843476 CTCTGCCTGTGGAAAGGGGAGGG + Intergenic
1044241522 8:89893528-89893550 CTATGCTTGTGCAAAGGGAAGGG + Intergenic
1044324248 8:90842022-90842044 CTGGGCCTGTGGGAGGGTGAGGG + Intronic
1044991262 8:97798267-97798289 CTATGTCTGTGCAAAGGGGTTGG - Intronic
1045041258 8:98227001-98227023 CTCTGCCTGGGGAAAGGGGAGGG - Intronic
1045159526 8:99523123-99523145 GCCTGCTTGTGGAAAGGGGAGGG + Intronic
1045172474 8:99686591-99686613 CACTGCTTGTGGAAAGTGGAGGG - Intronic
1045536996 8:103039718-103039740 CTGTGTGTGTGGGAAGGGGAAGG + Intronic
1045590001 8:103582696-103582718 CTCTGCCTTTGGAAAGAGGAGGG + Intronic
1045621273 8:103980836-103980858 TTCTGCCTGTGGTAAGGGGAGGG + Intronic
1045733377 8:105267227-105267249 CTTTGCCTGTGGAAAGAAGAGGG - Intronic
1045777394 8:105821850-105821872 CTCTGAATTTGGAAAGGGGAGGG - Intergenic
1045800719 8:106097460-106097482 TTTTGCTTGAGGAAAGGGGAAGG + Intergenic
1045994972 8:108351967-108351989 CTTTGCCTATGGAAAGGGGAGGG + Intronic
1045998819 8:108395528-108395550 CTGGATCTGTGGAATGGGGATGG - Intronic
1046169464 8:110485981-110486003 CTCTACCTTTGGAAAGGAGAGGG + Intergenic
1046268138 8:111858551-111858573 CTCTGCCTTTGAAAAGGTGAGGG - Intergenic
1046384053 8:113486249-113486271 CTCTCCCTGTGGAAAGAGGAGGG - Intergenic
1047032035 8:120892472-120892494 GTATACCTGTGGAAAGAGGAAGG - Intergenic
1047352368 8:124088261-124088283 CTCTGCTTGAGGAAAGGGGAAGG - Intronic
1047933695 8:129753907-129753929 CTCTACCTGTGAAAAGGGGAGGG + Intronic
1048118728 8:131555179-131555201 CTCTGCTTGAGGATAGGGGAGGG + Intergenic
1048591204 8:135822226-135822248 CTGTGGCTGTGGGAAAGGGGTGG + Intergenic
1048646715 8:136428695-136428717 CTCTGTCTGTGAAAAGGGAAGGG + Intergenic
1049205252 8:141360663-141360685 GAGTGCCTGGGGAAAGGAGAAGG + Intronic
1050238771 9:3612571-3612593 CTCTGCTTGAGGAAAGGGAAGGG - Intergenic
1050280243 9:4043118-4043140 GTGGGGCTGTGGGAAGGGGAGGG - Intronic
1050355928 9:4782457-4782479 CTCTGCCTGTGGAAAGTACAGGG + Intergenic
1050508280 9:6369487-6369509 CTATGCCTGCAGAAAGGGGAGGG + Intergenic
1050582571 9:7075959-7075981 CTATGACTGAGGAAAAGGGAGGG - Intronic
1050618563 9:7429117-7429139 CTCTGCTTGAGGAAGGGGGAGGG - Intergenic
1050644246 9:7702236-7702258 CTGCGCCTGTAGAAAAGAGATGG - Intergenic
1050865137 9:10488693-10488715 CTCTGCCTTTGGAAAGGGGAGGG - Intronic
1050914003 9:11108331-11108353 CTCTACCTTTGGAAAGGGAAAGG + Intergenic
1051465113 9:17368255-17368277 CTTTGCCTGTGGAAAGGGAAGGG + Intronic
1051916797 9:22217856-22217878 CTCTGCCTTTGGAAAGGGGAGGG + Intergenic
1051921814 9:22275329-22275351 CTCTGCCTGTGGAAAGGGGAGGG + Intergenic
1051991030 9:23153208-23153230 CTCTGTCTTTAGAAAGGGGACGG - Intergenic
1051992138 9:23163833-23163855 TTCTGCCTATGGAAAGGGGAGGG + Intergenic
1052063364 9:23987379-23987401 CTCTGCCTTTGGAAAGGGGAGGG + Intergenic
1052214584 9:25950949-25950971 CTCTGCCTTTGTAAAGGGGAGGG - Intergenic
1052420254 9:28234344-28234366 CTTTGACTATGTAAAGGGGAAGG + Intronic
1052585714 9:30425262-30425284 TTCTGCTTGAGGAAAGGGGAAGG - Intergenic
1052986983 9:34494927-34494949 CTGGGCCTGGGCAATGGGGAAGG - Intronic
1053040112 9:34863034-34863056 CTCTGCTTGTAGAAAGGGGAAGG + Intergenic
1053110271 9:35453681-35453703 CTTTGCCTGTGGAAATGGGAGGG + Intergenic
1053204534 9:36174779-36174801 CTCTGCTTATGGAAAGGGGAGGG + Intergenic
1053438039 9:38090278-38090300 CTCTGCCTGGGGGATGGGGACGG + Intergenic
1053559184 9:39171598-39171620 CTGTGGCTGTGGACATGAGAAGG + Exonic
1053823302 9:41991839-41991861 CTGTGGCTGTGGACATGAGAAGG + Exonic
1054137927 9:61447348-61447370 CTGTGGCTGTGGACATGAGAAGG - Intergenic
1054607271 9:67195526-67195548 CTGTGGCTGTGGACATGAGAAGG - Intergenic
1055227411 9:74015617-74015639 CTTTGCTTGTGGAAAGGGAAGGG + Intergenic
1055302108 9:74892447-74892469 CTCTGCCTGTGGCAAGTTGAAGG + Intergenic
1055692244 9:78845644-78845666 CTCTGCCTGTGGAAAGGGGAGGG - Intergenic
1055699946 9:78933115-78933137 CTCTGCCTGTAGGAAGAGGATGG + Intergenic
1055704704 9:78985021-78985043 CTGTGACTGTTCAAAGTGGAAGG + Intergenic
1055886412 9:81069148-81069170 GTCTGCCTGTGGAAAGGGGAGGG - Intergenic
1056007329 9:82286023-82286045 CTCTGCCTTTGAAAAGGGGAGGG + Intergenic
1056211196 9:84367113-84367135 CTCTGCCTTTGGAAAAGGGAGGG - Intergenic
1056424639 9:86464706-86464728 CTCTGCCTTTGGAAAGGGGAGGG - Intergenic
1056565821 9:87771565-87771587 CTGTGCCTGTACAGACGGGACGG + Intergenic
1056765455 9:89442129-89442151 CTGGGCCAGGGGAAAAGGGAAGG - Intronic
1057644488 9:96860030-96860052 CCCTGCCTGGGGAGAGGGGAGGG + Intronic
1058175208 9:101727844-101727866 CTGTGTCTGTGGCCAGGTGAAGG + Intronic
1058241653 9:102569661-102569683 CTCTCCCTCTGGAAAGAGGAGGG + Intergenic
1058249023 9:102668624-102668646 CTCTGCCTATGAAAAGGGGAGGG - Intergenic
1058522745 9:105828373-105828395 CTCTGCTTGAGGAAAGGGGAGGG - Intergenic
1058647886 9:107147473-107147495 CTGTGCCTGGGAAGTGGGGATGG + Intergenic
1058780220 9:108325608-108325630 TTCTGCTTTTGGAAAGGGGAAGG + Intergenic
1059331331 9:113537489-113537511 CAGTGCCTGGGGAGAGGGGATGG + Intronic
1059555423 9:115276043-115276065 CTCTGCTTGTAGAAAGGGGAGGG - Intronic
1059699406 9:116760655-116760677 TTGTGCCTGGGGAAGGGGGAGGG + Intronic
1059713312 9:116889391-116889413 CTGTGCCTGTGTTGAAGGGAGGG - Intronic
1060304553 9:122398812-122398834 CTCTGCCTGTGGGAAGGGGAGGG + Intergenic
1060375319 9:123111530-123111552 CTGTGCCTGTAGGCAGGGGCAGG + Intronic
1060447222 9:123701382-123701404 CACTGCCTGAGGTAAGGGGAGGG - Intronic
1061638347 9:131929673-131929695 TTCTGCCTGTGGAAAGGGGAGGG + Intronic
1061680620 9:132241070-132241092 CGGGGCCTGCGGAAAGGGGACGG + Intronic
1061915531 9:133751256-133751278 CTCTGCCTTTGGAAAGGAGAGGG - Intergenic
1061932778 9:133841869-133841891 CTGAGCTGGTGGAAAGCGGAAGG - Intronic
1062137082 9:134934887-134934909 CTGGGACAGAGGAAAGGGGAAGG - Intergenic
1062254052 9:135612818-135612840 CTGTGCCTGTGGCCAGGGGTGGG + Intergenic
1062306061 9:135907636-135907658 CTGCGCCTGCGGAAAGGGGCGGG - Intergenic
1062306078 9:135907687-135907709 CTGCGCCTGCGGAAAGGGGCGGG - Intergenic
1062306093 9:135907738-135907760 CTGCGCCTGCGGAAAGGGGCGGG - Intergenic
1062453307 9:136624523-136624545 CTGAGCCTGAGGACTGGGGATGG + Intergenic
1062562810 9:137149323-137149345 ATGTGACTGTGGAATGGGGAAGG - Intronic
1062699375 9:137890992-137891014 CTCTGCCTGTGGGTGGGGGATGG + Intronic
1186691840 X:11985802-11985824 CTCTGCCCATGGAAAGGGAAGGG + Intergenic
1186911620 X:14173928-14173950 CTCTGCCTGTGGAAAGGAGAGGG - Intergenic
1187314871 X:18183774-18183796 CTCTGCTTGTAGAAACGGGAGGG + Intronic
1187579269 X:20591452-20591474 CTCTGCCAGTGGAAAGGGGAGGG - Intergenic
1187594414 X:20755891-20755913 CTTTGCCTGTGGAAAGGGAAGGG - Intergenic
1187610531 X:20938779-20938801 CTTTGCCTTTGGAAAGGGGAGGG - Intergenic
1187618156 X:21020771-21020793 CTCCACCTGTGGAAAGGAGAGGG + Intergenic
1187623633 X:21086245-21086267 CTCTCCCTGTGGAAAGGAGGGGG + Intergenic
1187636875 X:21238698-21238720 CTTTGCCTAGAGAAAGGGGAAGG + Intergenic
1188210681 X:27419714-27419736 CTCTGCTCTTGGAAAGGGGAGGG + Intergenic
1188421067 X:29991550-29991572 CTTGGCCTGTGCAAAAGGGAGGG - Intergenic
1188749954 X:33893111-33893133 CTCTGCCTTTGAAAAGGGGATGG - Intergenic
1188846248 X:35076240-35076262 CTCTGCCTTTTGAAAAGGGAGGG - Intergenic
1188854194 X:35171924-35171946 TTCTGCTTGTGAAAAGGGGAGGG - Intergenic
1188864682 X:35300321-35300343 CTCTGCCTGTGAAAAGGAAAGGG + Intergenic
1188930117 X:36098594-36098616 CTCTGCCTTTGGAAAGGGGAGGG - Intronic
1188932006 X:36123523-36123545 CTCTGCCTTCGGAGAGGGGAGGG - Intronic
1188972255 X:36632539-36632561 CTTTGCCTGAGGAAAGGGGAGGG - Intergenic
1189019653 X:37320748-37320770 CACTGCCTTTGGAAAGGGGAAGG + Intergenic
1189411828 X:40779539-40779561 CTCTGCTTGTGGAAAGTGGAGGG - Intergenic
1189593904 X:42543877-42543899 CTCTGCCTGTGGAAAGGGGAGGG + Intergenic
1189690511 X:43612856-43612878 CTCTGCCTTTGAAAAGGGGAGGG - Intergenic
1189770006 X:44416424-44416446 CTATGCCTTTGGAAAGGAGCAGG - Intergenic
1189858391 X:45247485-45247507 CTCTGCCTTTGGAAAGGGGAAGG - Intergenic
1189868741 X:45360248-45360270 CTCTGCCTTTGGAAATGGGAAGG - Intergenic
1189915524 X:45851693-45851715 CTGTGGCGGTAGAAAGGGGATGG + Intergenic
1189921943 X:45910861-45910883 CTGTGTGTGTGGGGAGGGGAGGG + Intergenic
1190015179 X:46820272-46820294 CTCTGCCTGTGGAAAGGGGAGGG + Intergenic
1190046315 X:47113883-47113905 CTTTGCTTATGGAAAGGGGAAGG + Intergenic
1190114335 X:47616397-47616419 TTGTGATTATGGAAAGGGGAAGG + Intronic
1190374284 X:49774368-49774390 CTCTGCCTGTGGAAGGAGGAGGG - Intergenic
1190477239 X:50840198-50840220 CTGTGCCTGCAGAGAGAGGAAGG - Intergenic
1190614646 X:52217704-52217726 CTCTGCATTTGGAAAGAGGAGGG + Intergenic
1190893826 X:54596787-54596809 CTCTGCATTTGGAAAGGAGAGGG - Intergenic
1191059279 X:56277887-56277909 CTCTGGCTGTGGAAAGTGAAGGG - Intronic
1191198665 X:57752707-57752729 CTCTGCATTTGGAAAGGGGAGGG + Intergenic
1191207375 X:57849304-57849326 CTCTGCCTTTGGAAAGGGGAGGG - Intergenic
1191703805 X:64071273-64071295 CTTTGCCTTTGGAAAGGGGAGGG + Intergenic
1191829630 X:65402224-65402246 CTCTTCCTTTGGAAAGGAGAAGG + Intronic
1191910260 X:66142801-66142823 CTCTGCCTTTGCAAAGGTGAGGG - Intergenic
1192027194 X:67466272-67466294 TTCTGCCTTTGGAAAGGGGAGGG + Intergenic
1192054072 X:67755719-67755741 TTGTGCCTCTGGGAAGGCGAAGG + Intergenic
1192062220 X:67839144-67839166 CTCTGTCTTTGAAAAGGGGAGGG + Intergenic
1192073123 X:67962043-67962065 TTCTGCCTGAGGAAAGGAGAGGG + Intergenic
1192243783 X:69357005-69357027 CTATGCATGAGGAGAGGGGAGGG + Intergenic
1192380856 X:70614416-70614438 ATGGGCCTGTGGAAGTGGGAGGG + Intronic
1192393460 X:70754353-70754375 CTCTGCCTTTGGAAAGGGGGAGG + Intronic
1192397342 X:70795240-70795262 CTCTGCTTGTGGAAAGAGGAGGG + Intronic
1192406075 X:70887480-70887502 CTTTGCCTGGGGAAAAAGGAGGG + Intronic
1192505592 X:71680255-71680277 CTCTGCCTGTGGAACGGGCACGG - Intergenic
1192521472 X:71804879-71804901 CTCTGCCTGTGGAAAGGGTGGGG + Intergenic
1192640766 X:72859745-72859767 CTCTTCCTGTGGAAAGGGGAGGG + Intergenic
1192640945 X:72861031-72861053 CTCTTCCTGTGGAAAGGGGAGGG - Intergenic
1192667294 X:73101443-73101465 CTCTGCCTTTGGAAAGGAGAAGG - Intergenic
1192676261 X:73199737-73199759 CTCTGCCTTTTGAAAGTGGAAGG + Intergenic
1192694511 X:73400028-73400050 CTCTGCCTGGAGAAAGGGGAGGG + Intergenic
1192812614 X:74560374-74560396 CTCTGCCTTTAGAAAGGGGAGGG + Intergenic
1192836178 X:74801970-74801992 CTCTGCCTGTGGAAATGGGAGGG + Intronic
1192855913 X:75011728-75011750 CTCTGCCTTTGGAAATGGGAGGG - Intergenic
1192890979 X:75390122-75390144 GTGTATTTGTGGAAAGGGGAGGG + Intronic
1192908500 X:75578561-75578583 CTTTGCCTTTGAAAAGGGGAGGG - Intergenic
1193012896 X:76697339-76697361 CTCTGCCTTTGGAAAGGGGAGGG + Intergenic
1193052348 X:77115005-77115027 CTCTGCCTGGGAAAAGGGGAGGG - Intergenic
1193078725 X:77383058-77383080 CTTTGTCTTTGGAAAGGGGAAGG + Intergenic
1193092620 X:77510702-77510724 CTTTGCTTGTGAAAAGCGGAGGG + Intronic
1193210102 X:78797422-78797444 CTCTGCTTGTGGAAAGAGGTGGG - Intergenic
1193213903 X:78840033-78840055 CTGTGCTTGAGGAAAGGAGATGG + Intergenic
1193337333 X:80306493-80306515 ATCTGTCTTTGGAAAGGGGAAGG - Intergenic
1193409067 X:81141070-81141092 CTCTGCCTTTGAAAAGGAGAGGG + Intronic
1193438782 X:81513071-81513093 CTCTGCCTTTAGAAAGGGGAGGG + Intergenic
1193488266 X:82115135-82115157 CTCTGCTTGTGTAAATGGGAGGG - Intergenic
1193504917 X:82330376-82330398 TTTTGCCTGTGGAAAGGGGAGGG - Intergenic
1193650364 X:84123597-84123619 TTCTCCCTGTGGAGAGGGGAGGG + Intronic
1193664645 X:84300490-84300512 CTGTGCCTTTGGAAAGGGGAGGG + Intergenic
1193683677 X:84552426-84552448 CTCTGCCTTTGGAAAGGGGAGGG - Intergenic
1193856494 X:86610191-86610213 CTTTGCCTTTGGAAATGGGAGGG - Intronic
1193876537 X:86868954-86868976 CTCTGCCTTTAGAAAGGGTAAGG - Intergenic
1193894895 X:87100876-87100898 CTCTGACTGTGGAAAGGGGAAGG + Intergenic
1193897071 X:87127426-87127448 CTCTGCTTGAGGAAAGGGGAGGG + Intergenic
1193925182 X:87475936-87475958 CTCTGCTTTTGAAAAGGGGAGGG - Intergenic
1193930317 X:87544230-87544252 CTCTGCCTTTGGAAAGGGGAGGG + Intronic
1193957874 X:87885510-87885532 CTCTGCCTTTGGAAAGAGGAGGG - Intergenic
1193984976 X:88229154-88229176 CTTTGCCTTTGGAAAGGTGAGGG + Intergenic
1194112691 X:89854468-89854490 CTCTGCCTTTGGAAAGAGAAAGG + Intergenic
1194157824 X:90415306-90415328 CTCTGCCTTTGGAAAGAGGAAGG - Intergenic
1194165120 X:90506133-90506155 CTCTGCCTTTGGAAAAGGGAGGG + Intergenic
1194170526 X:90575189-90575211 ATGTGCCAGCAGAAAGGGGAAGG + Intergenic
1194265004 X:91743102-91743124 CTCTGCCTTTGGAAAGGAGAGGG - Intergenic
1194285627 X:92007344-92007366 CTCTGCCTTTGGAAAGAGGGGGG - Intronic
1194327652 X:92540294-92540316 CTCTGCCTGTGGAAAGAGGAGGG - Intronic
1194329264 X:92560694-92560716 CTCTGCCTTTGTAAAGGGGATGG + Intronic
1194338652 X:92682049-92682071 CTCTGCCTGTGGAAAGGGGAGGG - Intergenic
1194352291 X:92835150-92835172 CTCTGCCTCTGAAAAGGGGATGG + Intergenic
1194360984 X:92950343-92950365 CTCTGCCTTTGGAAAGGGTAGGG - Intergenic
1194372452 X:93090960-93090982 CTCTGCCTTTGGATAGGGGAGGG - Intergenic
1194389233 X:93295226-93295248 CTCTGTCTTTGGAAAGGGAAGGG + Intergenic
1194457525 X:94123503-94123525 CTCTGCATTTGGAAAGGGGAGGG - Intergenic
1194495531 X:94613028-94613050 CTCTGCCTTTGGAAAGGGGAGGG - Intergenic
1194586159 X:95736613-95736635 TTCTGTCTGTGGAAAGGGGAGGG + Intergenic
1194591567 X:95805777-95805799 CTCTGCCTTTGAAAAGGAGAGGG + Intergenic
1194623665 X:96202600-96202622 TTCTGCCTTTGGAAAGGGAAGGG + Intergenic
1194692867 X:97009160-97009182 CTCTGCTTGTGAAAAGGGGAGGG - Intronic
1194780732 X:98022896-98022918 CTCTGCCTGTGGAAAGGGGTGGG - Intergenic
1194783791 X:98057663-98057685 CTCTGCCTTTGGAAAGGGGAGGG - Intergenic
1194788776 X:98119310-98119332 CTCAGCCTTTGGAAGGGGGAAGG + Intergenic
1194795821 X:98210348-98210370 TTCTGCTTGAGGAAAGGGGAGGG + Intergenic
1194795941 X:98210985-98211007 CTCTGCCTGCAGAAAGGGGAGGG + Intergenic
1194823457 X:98532517-98532539 CTCTGCCTTTGGAAAGGGGAGGG + Intergenic
1194857809 X:98956157-98956179 CTCTGCCTTTGGAAAGGGGAAGG - Intergenic
1194892227 X:99394488-99394510 TTATGCTTGTGGAAAGGGAATGG - Intergenic
1195014599 X:100766073-100766095 CTCTGCCTTTGGAAAGGGGAGGG - Intergenic
1195090062 X:101450302-101450324 ATCTGCCTGTGGGAAGGGGAGGG - Intronic
1195115824 X:101696767-101696789 CTCTGCATGTGGAAAGGGGAGGG + Intergenic
1195116514 X:101704401-101704423 GTGTGTATGTGGAATGGGGATGG - Intergenic
1195172216 X:102280929-102280951 TTGTACCTTTGGGAAGGGGAGGG - Intergenic
1195186644 X:102406164-102406186 TTGTACCTTTGGGAAGGGGAGGG + Intronic
1195199417 X:102533195-102533217 TACTGACTGTGGAAAGGGGAGGG + Intergenic
1195478410 X:105314871-105314893 CAGTCCCTCTGGAAAAGGGAGGG + Intronic
1195502151 X:105613746-105613768 CTTTGCCTGCAGAAAGGGGAGGG + Intronic
1195543283 X:106087334-106087356 CTCTGTCTATGGAAAGGGGAGGG - Intergenic
1195660278 X:107371183-107371205 GTGTGCGTGTGGAGTGGGGAGGG - Intergenic
1195823384 X:108970822-108970844 CTCTGCATGAGGAAAGGGGAGGG + Intergenic
1195834839 X:109102668-109102690 CTCTGCCTTTGAAAAGGGAAGGG - Intergenic
1195852104 X:109294830-109294852 TTCTGCCTTTGGAGAGGGGAAGG - Intergenic
1195917282 X:109948149-109948171 CTCTGCTTGTGGAAAGGGGAGGG + Intergenic
1195987917 X:110651329-110651351 CTGTGCCTCAGGAAATAGGAAGG + Intergenic
1196226253 X:113170975-113170997 CTTTGCCTTTGGAAAGGGGAGGG - Intergenic
1196304706 X:114087444-114087466 CTCTGCATGTGGAAGGTGGAGGG + Intergenic
1196399495 X:115299528-115299550 CTCTGCCTTTGGAAAGGGAAGGG - Intronic
1196461320 X:115935141-115935163 CTTTACATTTGGAAAGGGGAGGG - Intergenic
1196467865 X:115991490-115991512 CTCTGCCACTGGAAAGGGAAGGG + Intergenic
1196471278 X:116031448-116031470 CTCTGCATTTGGAAAGGGGAGGG - Intergenic
1196523767 X:116707372-116707394 TTCTGCCTTTGGACAGGGGAGGG - Intergenic
1196532484 X:116805759-116805781 CTATCCCTGTGGAAAGGGGAGGG - Intergenic
1196538907 X:116882407-116882429 CTTTGCATTTGGAAAGGGGAAGG - Intergenic
1196552568 X:117046078-117046100 TTCTGTCTGTGGAAAGGGGAGGG + Intergenic
1196573344 X:117289040-117289062 CTGTACCTTTGGAAACAGGAGGG + Intergenic
1196579124 X:117359013-117359035 TTCTGCCTTTGGAAAGGGGAGGG - Intergenic
1196591003 X:117485201-117485223 TTCTGCCTTTGGAAAGGGGAGGG - Intergenic
1196609621 X:117696138-117696160 CTCTGCCTTTGAAAAGAGGAGGG + Intergenic
1196619660 X:117807386-117807408 CTCTGCTTGTGGAAAGGGAAGGG + Intergenic
1196625392 X:117871731-117871753 CTCTGCCTTTGCAAAAGGGAAGG + Intergenic
1196660582 X:118264611-118264633 CTCTGCCTTTGGAAAGGGGAGGG + Intergenic
1196865414 X:120066376-120066398 CTTTGCCTTTGGAAAGGGGAGGG + Intergenic
1196877680 X:120169904-120169926 CTTTGCCTTTGGAAAGGGGAGGG - Intergenic
1196984485 X:121253537-121253559 CTCTGCCTTTGGAAAGGGGCGGG - Intergenic
1197011637 X:121571018-121571040 TTCTGCATGTGGAAAAGGGAAGG + Intergenic
1197053967 X:122094533-122094555 CTCTGCCTGGGGAAAGGGGAAGG + Intergenic
1197068632 X:122266612-122266634 CTGTGCCTTTGGAAAAAAGAAGG - Intergenic
1197099508 X:122636341-122636363 CTCTGCTTGAGGAAAGGGGAGGG - Intergenic
1197139171 X:123097090-123097112 CTCTGCCTTTGGAAGAGGGAGGG + Intergenic
1197363161 X:125532464-125532486 CTCTGCCTTTGAAAAGGGGAGGG - Intergenic
1197376051 X:125682808-125682830 CTCTGCCTGGGAAAAGGGGAGGG + Intergenic
1197438028 X:126456353-126456375 CTCTGCATTTGGAAAGAGGAGGG + Intergenic
1197449490 X:126594287-126594309 CTCTGCCTTTGGGAAGGGGAGGG - Intergenic
1197458392 X:126707056-126707078 CTCTGCCTTTGGAAAGGGGAGGG + Intergenic
1197524420 X:127544892-127544914 CTCTGCCATTGGAAAGAGGAGGG - Intergenic
1197544525 X:127808617-127808639 GTCTGCCTTTGGAAAGGGTAGGG + Intergenic
1197561971 X:128034809-128034831 TTCTTCCTGTGGAAAGGGGAGGG + Intergenic
1197661473 X:129178668-129178690 TTCTGCCTTTGGAAAGGGGAGGG - Intergenic
1197810773 X:130441416-130441438 CTCTGCCTTTGGAAAGGGGAGGG - Intergenic
1198430751 X:136564456-136564478 CTTTGCATGTAGAAAGGGGAGGG - Intergenic
1198515155 X:137399966-137399988 TTCTGTCTGTGGAAAGGAGAGGG - Intergenic
1198697180 X:139354682-139354704 CTCTGCCTGTGGAAATTAGAAGG - Intergenic
1198788237 X:140314141-140314163 CTCTGCCTTTGGAAAGGAGAAGG + Intergenic
1198818018 X:140614079-140614101 CTCTCCCTTTGGAAAGAGGAGGG - Intergenic
1198841083 X:140858868-140858890 TTTTGCCTGTGGAAAGGGGAAGG + Intergenic
1198927401 X:141814591-141814613 CTCTGCCTTTGGAAAGGGGAGGG - Intergenic
1198938850 X:141931169-141931191 CTTTGCATGTGGAAAGGGAAAGG - Intergenic
1198947510 X:142031161-142031183 CTCTGCCTGTTGAAAGGGGTGGG - Intergenic
1199005780 X:142694127-142694149 CTCTGCCTATGGAAAGGAGAGGG + Intergenic
1199036125 X:143053003-143053025 CCTTGCCTTTGGAAAGGGGAAGG - Intergenic
1199058829 X:143329156-143329178 CTCTGCCTTCAGAAAGGGGAGGG + Intergenic
1199081200 X:143578839-143578861 CTCTGCCTTTGGAAAAGGGAGGG - Intergenic
1199163859 X:144647461-144647483 CTCTGCCTTTGGAAAGGGCAGGG - Intergenic
1199173654 X:144759093-144759115 CTCTGCTTTTGGAAAGGGAATGG + Intergenic
1199197542 X:145048550-145048572 CTCTGCCTGTAAAAAGGGGAGGG + Intergenic
1199374189 X:147088090-147088112 CTCTGCGTTTGGAAAGGAGATGG - Intergenic
1199441034 X:147867615-147867637 CTCTGCCTCTGGAAAGAGGAGGG + Intergenic
1199457340 X:148043972-148043994 CTCTGCTTGAGGAAAGGTGAGGG - Intergenic
1199485156 X:148338805-148338827 CTCTACCTGTGGAAACGGGAGGG + Intergenic
1199526927 X:148803354-148803376 CTGTCCCTGTGGAACCGGGCTGG + Intronic
1199608416 X:149594392-149594414 CAGTTTCTGTGGAAAGGGGAGGG + Exonic
1199630704 X:149774968-149774990 CAGTTTCTGTGGAAAGGGGAGGG - Exonic
1199908508 X:152260145-152260167 CTCTGCCTATGAAAAGGGGAAGG + Intronic
1200315933 X:155132999-155133021 CTCTGCCTGTGGAAGGGGGAGGG + Intronic
1200364222 X:155644577-155644599 CTCTGCCTATGGAAAGGAGAGGG - Intronic
1200431505 Y:3088330-3088352 CTGAGACGGTGGAAGGGGGAGGG - Intergenic
1200465344 Y:3509279-3509301 CTCTGCCTTTGGAAAGAGAAAGG + Intergenic
1200504156 Y:3992275-3992297 CTCTGCCTTTGGAAAGAGGAAGG - Intergenic
1200511385 Y:4083933-4083955 CTCTGCCTTTGGAAAAGGGAGGG + Intergenic
1200516769 Y:4152949-4152971 ATGTGCCAGCAGAAAGGGGAAGG + Intergenic
1200582154 Y:4963548-4963570 CTCTGCCTTTGGAAAGGAGAGGG - Intergenic
1200592000 Y:5087136-5087158 CTCTGCCTTTGGAAAGTAGAGGG - Intronic
1200636363 Y:5659512-5659534 CTCTGCCTGTGGAAAGAGGAGGG - Intronic
1200637963 Y:5679883-5679905 CTCTGCCTTTGTAAAGGGGATGG + Intronic
1200647043 Y:5798831-5798853 CTCTGCCTGTGGAAAGGGGAGGG - Intergenic
1200648959 Y:5817417-5817439 CTCTAACTATGGAAAGGGGAGGG - Intergenic
1200660599 Y:5951888-5951910 CTCTGCCTCTGAAAAGGGGATGG + Intergenic
1200669183 Y:6066155-6066177 CTCTGCCTTTAGAAAGGGTAGGG - Intergenic
1200680494 Y:6205003-6205025 CTCTGCCTTTGGATAGGGGAGGG - Intergenic
1201187401 Y:11417304-11417326 ATGTCCCTGTGGAAAGAGGGAGG - Intergenic
1201762471 Y:17555193-17555215 CTCTGCCTTTGGAAAAGGAAAGG + Intergenic
1201839081 Y:18350795-18350817 CTCTGCCTTTGGAAAAGGAAAGG - Intergenic