ID: 1155288011

View in Genome Browser
Species Human (GRCh38)
Location 18:24311303-24311325
Sequence TCAGTCTGAATAATTACGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 57}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155288011 Original CRISPR TCAGTCTGAATAATTACGTC AGG (reversed) Intronic
905544140 1:38784315-38784337 TCAGCCTGAATAATTAATTAAGG + Intergenic
906994320 1:50774444-50774466 TCAGTCTGAAAAAGTAGTTCAGG - Intronic
912233302 1:107820675-107820697 TAAGGCTTAATAATTACATCAGG - Intronic
912674187 1:111661877-111661899 TTATTCTGAAGAATTACGTTGGG - Intronic
923028424 1:230225901-230225923 CCATTCTGAATAAGTAGGTCTGG - Intronic
924866791 1:247991461-247991483 TCAGGATAAATAATTATGTCTGG + Intronic
1076523869 10:131098597-131098619 GCAGTCTGAATAATTAAACCTGG + Intronic
1081634061 11:44709094-44709116 ACAGTCTGAATAATTCCTTCTGG - Intergenic
1087005591 11:93467528-93467550 TCAGGCTGAATAAAGACTTCTGG - Intergenic
1087246846 11:95849215-95849237 TCAGTCTGAATAACTTGTTCAGG + Intronic
1088074292 11:105827236-105827258 TTAGTCTGAATAAATACTTTTGG - Intronic
1094533638 12:31301383-31301405 TCAGGCAGAATAATTTTGTCAGG - Intronic
1095504599 12:42881384-42881406 TCAGTCTGAATATTTTCTTTTGG + Intergenic
1099594658 12:84645063-84645085 GCAGTCTGAATGAATAGGTCTGG - Intergenic
1107720043 13:43238778-43238800 TCATTCTGAATAATTTCATTTGG - Intronic
1107770193 13:43780922-43780944 CCAGTCTGGATAATTACATTGGG + Intronic
1111916628 13:94367678-94367700 TCAGTCTGAATAATCCTGTCTGG - Intronic
1120798202 14:88659519-88659541 TGACTCTTAATAATTAAGTCAGG + Intronic
1125133606 15:36313968-36313990 GCAGTCTTAAAAATTACTTCTGG - Intergenic
1131784976 15:95902903-95902925 TCATTTTGATTAATTATGTCAGG - Intergenic
1132825774 16:1904540-1904562 TCAGTCTGAGTAATTCCGGTGGG - Intergenic
1135071608 16:19357035-19357057 TCAGTCTGAGTAATGGCATCTGG - Intergenic
1148565480 17:48630625-48630647 TGAGTCTGAAGAAATACCTCTGG - Intronic
1149154227 17:53607241-53607263 TCAGTCTTAATAATGATTTCAGG + Intergenic
1150233316 17:63571587-63571609 TCATTTTTAAAAATTACGTCAGG + Intronic
1150459778 17:65339976-65339998 TCAGTGTCAATAATCACATCTGG + Intergenic
1155288011 18:24311303-24311325 TCAGTCTGAATAATTACGTCAGG - Intronic
1156732733 18:40214629-40214651 TCAGTCTGAATAATTCCACTTGG - Intergenic
1165752165 19:38266883-38266905 TCAGTTTAAGTAATTACGTTAGG + Intronic
1168575135 19:57503073-57503095 TCAGTGGGAATAATTAAGTTAGG + Intronic
942512408 2:176716649-176716671 ACAGTATTAATAATTATGTCAGG + Intergenic
942959381 2:181811768-181811790 TCACTATTAATAATTAGGTCAGG + Intergenic
945697909 2:213131818-213131840 TTAATCTGAATAATAATGTCTGG + Intronic
946939533 2:224756583-224756605 TGAGCCTGAATAATTAAGTAAGG - Intergenic
1175563172 20:59950391-59950413 TCAGTTAGAATAATGAGGTCAGG + Intergenic
1177603720 21:23351432-23351454 TCAGTCTTAATTATTAAGTTAGG - Intergenic
958508301 3:95011523-95011545 CCACTTTGAATAATTCCGTCAGG + Intergenic
962034251 3:131634374-131634396 TCACTTTGAATAATTTCTTCAGG + Intronic
962126164 3:132620975-132620997 TCATTCTGAGTAATTTCTTCAGG - Intronic
986419298 5:7561843-7561865 AGAATCTGAATAATTCCGTCTGG - Intronic
986691387 5:10316527-10316549 TGAGTCTGAATACTTTCGGCAGG - Intergenic
992204528 5:74418147-74418169 TCTCTCTGTATAATTACGTTAGG + Intergenic
1003098381 6:3158917-3158939 TCTTTGTGAATAATTAAGTCAGG - Intergenic
1008394430 6:50990514-50990536 TCAGCCTGAACAACTACATCAGG - Intergenic
1010712855 6:79195384-79195406 TCAGACTGATTAAATACATCCGG - Intergenic
1010845908 6:80706932-80706954 TGAGTTTGAATAATTGCTTCTGG + Intergenic
1012250347 6:96973317-96973339 TCAGTCTTAATAATAAGGACAGG + Intronic
1016979059 6:149837645-149837667 GGAGTCTGAAGAATTAAGTCGGG - Intronic
1023335800 7:39168585-39168607 TCAGTCACAACCATTACGTCAGG - Intronic
1032352153 7:131174634-131174656 TGAGTCTGTTTAATCACGTCAGG - Intronic
1037576620 8:20211209-20211231 CCAGTCTGAATCATTTCCTCTGG - Exonic
1040956541 8:52985342-52985364 TCAATCTGGAAAATTAAGTCTGG + Intergenic
1042407305 8:68420830-68420852 TCATTCTGAATATTTTCTTCTGG - Intronic
1045733665 8:105270195-105270217 TCAGCCTAAATAATTTCCTCTGG + Intronic
1059001666 9:110355031-110355053 TCATTCTGAATAGTTCCATCTGG - Intergenic
1187656055 X:21475251-21475273 ACAATGTGAATAATTACATCAGG - Intronic
1189417137 X:40825311-40825333 TCTGTCTGAATAATTGAGTCTGG + Intergenic
1192634401 X:72804166-72804188 GCAGTCTGTAGAATTACCTCAGG + Intronic
1192647309 X:72916635-72916657 GCAGTCTGTAGAATTACCTCAGG - Intronic
1195995281 X:110725431-110725453 TCAGTCTGAATAACTGCCACAGG + Intronic
1201442351 Y:14022121-14022143 TCAGTAAGAATAATTAGGCCAGG + Intergenic