ID: 1155293931

View in Genome Browser
Species Human (GRCh38)
Location 18:24368575-24368597
Sequence TCGATGTCTTCACCTCTAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 199}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155293931 Original CRISPR TCGATGTCTTCACCTCTAAA GGG Intronic
901042659 1:6374688-6374710 TCAGTGTCTTCACCTGTAAATGG + Intronic
901909074 1:12439794-12439816 TCAGTGTCTTCATCTATAAATGG - Intronic
902809763 1:18881516-18881538 TCCATTTCTTCACCTGTACAGGG - Intronic
903380174 1:22891119-22891141 TCTGTGTCTTCATCTGTAAAAGG - Intronic
904033068 1:27545211-27545233 TTGCTGTCTTTCCCTCTAAATGG + Intronic
904474394 1:30755628-30755650 CCGATGTCCTCACCTGTAAATGG - Intronic
904664018 1:32106242-32106264 TCAATTTCCTCATCTCTAAAAGG + Intergenic
904886943 1:33745932-33745954 TCAGTGTCTTCATCTTTAAATGG - Intronic
906536886 1:46555930-46555952 TCAGTTTCTTCAACTCTAAATGG - Intergenic
906866118 1:49422340-49422362 TCTATGTCTTCACAAATAAATGG + Intronic
908404158 1:63797509-63797531 TGGATGTGTTCACCTGTAAATGG - Intronic
909342076 1:74543493-74543515 TCGGTGTGTTCATCTGTAAATGG - Intronic
910686906 1:89926907-89926929 TCTATTTCTTCCCCTCTCAAGGG + Intronic
910875978 1:91878567-91878589 TTGATGTTCTCACCTATAAAAGG + Intronic
912241565 1:107915529-107915551 TCGATGTCCTCATCTATAGAGGG + Intronic
918374096 1:183891423-183891445 TCAATGTTCTCACCTCTACAAGG - Intronic
921479896 1:215652183-215652205 TCAATTTCCTCACCTTTAAAAGG - Intronic
921723624 1:218500835-218500857 TCCGTTTCTTCACCTGTAAATGG + Intergenic
922083825 1:222325902-222325924 TCAATTTCTTTACCTATAAAGGG - Intergenic
922083940 1:222326972-222326994 TCAATTTCTTTACCTATAAAGGG - Intergenic
922126152 1:222726171-222726193 TTAATGTCTTCACCTTTCAATGG + Intronic
1064692991 10:17937097-17937119 TCAATGTCTTTATCTCTAAAAGG - Intergenic
1066170235 10:32835599-32835621 TGCATGTCCTCACCTATAAATGG + Intronic
1067469788 10:46528082-46528104 TGGATGTTTTCACCACAAAAAGG + Intergenic
1068218871 10:54017554-54017576 TGCATGTTCTCACCTCTAAATGG + Intronic
1068698455 10:59994736-59994758 TCAATTTCTTCATCTTTAAATGG - Intergenic
1071131101 10:82394439-82394461 TGGATGTCTCACCCTCTAAATGG - Intronic
1072853077 10:98917553-98917575 TCCAATTCTTCACCTTTAAAAGG + Intronic
1073834347 10:107423994-107424016 TCGATTTCTTCATCTGTAAAAGG - Intergenic
1074001375 10:109376864-109376886 TCAGTTTCTTCACCTATAAAAGG - Intergenic
1076189496 10:128472878-128472900 TTGGTTTCTTCACCTGTAAATGG + Intergenic
1076606450 10:131692709-131692731 TCGAGGTCTCCACCTCCTAAGGG - Intergenic
1077808046 11:5609265-5609287 AAGATGTCCTCACCTCCAAACGG - Intronic
1078845598 11:15116149-15116171 TGGAAGTTTTCACTTCTAAAAGG - Intronic
1078965149 11:16330784-16330806 TCGATTTCCTCAGCTCAAAAAGG - Intronic
1079028934 11:16971194-16971216 TCAATTTCTTCACCAATAAAAGG + Intronic
1079399713 11:20096514-20096536 TCACTTTCTTCACCTTTAAATGG - Intronic
1080812320 11:35716879-35716901 TCAATTTCTTCATCTGTAAATGG + Intronic
1081308549 11:41543092-41543114 TCCATTTCCTCATCTCTAAAAGG + Intergenic
1083739914 11:64703389-64703411 TTGGTTTCTTCAGCTCTAAAAGG - Intronic
1083786864 11:64954788-64954810 TCTATCTCTTCTCCTCTAGAAGG + Exonic
1085728659 11:78977428-78977450 TCAATGTATTCATCTGTAAAAGG - Intronic
1085974034 11:81630098-81630120 TCAATGTCCTCATCTCTGAAAGG + Intergenic
1086263561 11:84970637-84970659 TCGAAGTCCTAACCCCTAAAGGG - Intronic
1088923035 11:114275568-114275590 TCAGTGTCTTCATCTGTAAAAGG + Intronic
1092013432 12:5136366-5136388 TCCATGTCTTCACTTGTAACTGG - Intergenic
1093678902 12:21977325-21977347 TCAATGTCATCACTTCTAAGAGG + Intergenic
1093678965 12:21978147-21978169 TCAATGTCATCACTTCTAAGAGG + Intergenic
1094429480 12:30351690-30351712 TCAATTTCTTCATCTGTAAATGG + Intergenic
1096096900 12:48941433-48941455 TCCATATCTGCACCTGTAAATGG + Intronic
1098895558 12:76056636-76056658 TCCATGTCTTCACTTGAAAATGG + Intronic
1099117087 12:78641281-78641303 TCTATGTCTTCATCTATAAGTGG + Intergenic
1101695290 12:107119813-107119835 TTGGTTTCCTCACCTCTAAATGG - Intergenic
1102740515 12:115203354-115203376 TCAGTTTCTTCACCTGTAAATGG - Intergenic
1102754526 12:115326765-115326787 TTGATTTCTTTACCTGTAAAGGG - Intergenic
1102899977 12:116628823-116628845 TCAATGTCTCCACCTCCAAAAGG + Intergenic
1107608255 13:42083994-42084016 TCGCTGTCTCTACCTGTAAAAGG - Intronic
1109496570 13:63179276-63179298 TCAATGACTTCATCTGTAAATGG - Intergenic
1112772696 13:102808365-102808387 TCAATTTCTTCACCTACAAATGG - Intronic
1114367260 14:22042677-22042699 TCCATGTCTTCACCAAAAAATGG + Intergenic
1115935803 14:38551132-38551154 TCCAAGTCATCACCTCTACAAGG + Intergenic
1117237456 14:53793384-53793406 TCTGTTTCTTCACCTGTAAAGGG + Intergenic
1118668442 14:68096277-68096299 TCGAAGTACTCATCTCTAAAAGG - Intronic
1119744848 14:77036871-77036893 TCCATTTCTTCACCTGTCAAAGG + Intergenic
1121548273 14:94779033-94779055 TTGATGTCCTCACCTGTAACAGG - Intergenic
1122202135 14:100128987-100129009 TCAATTTCCTCATCTCTAAAGGG - Intronic
1125030133 15:35067905-35067927 TCTATTTCCTCATCTCTAAACGG - Intergenic
1125412508 15:39420178-39420200 TCAATGTATTCATCTCTAAAAGG - Intergenic
1125644079 15:41256157-41256179 TCAATTTCCTCAGCTCTAAAAGG + Intronic
1127085678 15:55422478-55422500 TCTTTGCCTTGACCTCTAAATGG - Intronic
1127323181 15:57867472-57867494 TTGTTGTTTTCACCTCCAAAGGG + Intergenic
1129328972 15:74816979-74817001 TCAATGTCCTGACCTGTAAATGG - Intronic
1129701282 15:77769903-77769925 TCGGTTTCTTCACCTGAAAATGG - Intronic
1130091547 15:80825169-80825191 TTATTGTCTTCACCTATAAATGG - Intronic
1130690242 15:86075989-86076011 CTAATGTCATCACCTCTAAAAGG - Intergenic
1134561274 16:15211985-15212007 TCGGTTTCTTCATCTCTAGAAGG + Intergenic
1134921812 16:18123605-18123627 TCGGTTTCTTCATCTCTAGAAGG + Intergenic
1135660270 16:24290557-24290579 TGAGTGTCTTCACCTCTAATGGG + Intronic
1137750627 16:50858756-50858778 TCCATCTCTTCATCTTTAAAAGG - Intergenic
1140408322 16:74725593-74725615 TCCATTTCCTCAGCTCTAAAAGG + Intronic
1141497039 16:84417347-84417369 TCGATCTCCTCATCTCTAAAAGG + Intronic
1143996942 17:11014637-11014659 TCAATTTCCTCACCTATAAAAGG - Intergenic
1144834013 17:18147544-18147566 TCCAAGTTTTCACCTATAAAAGG - Intronic
1144992459 17:19243050-19243072 TTGGTGTCCTCATCTCTAAAGGG + Intronic
1150637092 17:66920978-66921000 TCGATGACTTCATCTCTTACTGG - Intergenic
1150891130 17:69151344-69151366 TTAATATCTTCACCTCCAAAAGG + Intronic
1151393168 17:73801593-73801615 TCCATGTCCTCACCTGTAGAAGG + Intergenic
1155293931 18:24368575-24368597 TCGATGTCTTCACCTCTAAAGGG + Intronic
1156408976 18:36809754-36809776 TCCTTGTCTTCACCACTAGATGG - Intronic
1156571252 18:38255950-38255972 TCAATTTCTTCACCTGCAAATGG - Intergenic
1156799571 18:41093122-41093144 TCCATGTCTTCAACTCACAAAGG + Intergenic
1158305968 18:56105812-56105834 TCAATGGCTTCAGCTATAAATGG - Intergenic
1160042391 18:75357566-75357588 TCAATCTCTTCACCTATGAAAGG + Intergenic
1162057881 19:8075673-8075695 TCGATGTCCTCAGCTGTATATGG + Intronic
1163200589 19:15765472-15765494 TGTATGTTTTCACCTCTAAGTGG - Intergenic
1165474462 19:36022339-36022361 TCAATGTCTTCATCCGTAAATGG - Intronic
1165924067 19:39316124-39316146 TCGGTTTCTTCATCTGTAAAAGG + Intergenic
925777083 2:7346303-7346325 TCAGTGTCTTCACATTTAAATGG - Intergenic
926882097 2:17557156-17557178 TCAATTTCTTCACCTCAAATAGG - Intronic
927130964 2:20060111-20060133 TCAGTTTCTTCACCTGTAAAAGG + Intergenic
929949344 2:46394318-46394340 TCGGTTTCTTCATCTCCAAATGG - Intergenic
930058967 2:47272835-47272857 GCGATGTCTTCAACTCTTATTGG + Intergenic
931854959 2:66293381-66293403 TCAATTTCTTAATCTCTAAAAGG - Intergenic
931910565 2:66895250-66895272 TCAATGACTCTACCTCTAAAAGG + Intergenic
934745955 2:96760047-96760069 TCAATTTCTGCATCTCTAAATGG + Intergenic
937955064 2:127417491-127417513 TCCAAGTCTGCACCTCTAAACGG - Intergenic
938921858 2:136002501-136002523 TCAATTTCTTCATCTGTAAAGGG - Intergenic
941104286 2:161334480-161334502 TCAATTTCCTCACCTGTAAAGGG - Intronic
944525373 2:200613606-200613628 GCCATGTCCTCACCTGTAAAAGG - Intronic
945036772 2:205710344-205710366 TCGATGTCTGCATCTGCAAATGG + Intronic
945650445 2:212551932-212551954 TTGATTTCTTCATGTCTAAAAGG - Intergenic
946021204 2:216641488-216641510 TCCATCTCTTCACCTATGAATGG + Intronic
947247097 2:228060939-228060961 GCGATGGCTTCATCTCTAAGAGG + Intronic
947415628 2:229892523-229892545 ACAATGTCTTTACCTCTGAAAGG - Intronic
1168939359 20:1695530-1695552 TCAATGTCTTCATCTGTAAAAGG + Intergenic
1175116833 20:56688824-56688846 TCCATTTCCTCACCTGTAAAAGG - Intergenic
1176226753 20:64004673-64004695 TCCATGTCTTCCTCTGTAAAAGG + Intronic
1177795331 21:25772161-25772183 TTAATGTCTTCAGATCTAAAGGG + Exonic
1181771943 22:25131856-25131878 TCACTGTCTTCCCCTCTGAAGGG + Intronic
1182413485 22:30206128-30206150 TCGGTGTCCTCATCTGTAAATGG - Intergenic
1182818626 22:33192224-33192246 TCAGTTCCTTCACCTCTAAAAGG - Intronic
1184633035 22:45801026-45801048 TCGTTTTCTTTACTTCTAAAAGG - Intronic
1185427391 22:50780484-50780506 TGGATGTGTTAACCTCTTAATGG + Intronic
950089774 3:10287393-10287415 TCCATTTCTTCCCCTCTACAGGG + Intronic
952553878 3:34509796-34509818 TCCATTTCTTCACTTCTAAAGGG - Intergenic
954469476 3:50679765-50679787 ATGATGTCTTTACCTCTAAAGGG - Intronic
954909152 3:54088282-54088304 CCGATGCCCTCACCTCTAAGAGG - Intergenic
954921265 3:54193123-54193145 TTCATGCCTTCACCTGTAAAAGG - Intronic
955220423 3:57018829-57018851 TCGATGTCTTCATCTGTAAAAGG - Intronic
955896252 3:63703998-63704020 TCATTTTCTTCACCTGTAAATGG + Intergenic
958660840 3:97064674-97064696 TAAATGTCATTACCTCTAAACGG - Intronic
962830001 3:139131461-139131483 TCGGTTTCTTTATCTCTAAATGG + Intronic
963185812 3:142415474-142415496 TCAATTTCTTCATCTGTAAAAGG + Intronic
963194193 3:142508336-142508358 TCTATTTCTTTACCTATAAAAGG + Intronic
963923717 3:150929551-150929573 TCAATTTCTTCATCTATAAAAGG + Intronic
963934048 3:151034341-151034363 TGGGTGTCTTCACATCCAAATGG + Intergenic
965657733 3:171006798-171006820 TCTATTTCTTGACATCTAAATGG + Intronic
966103702 3:176309137-176309159 TCCTTGTCTTCATCTGTAAATGG - Intergenic
966274126 3:178143928-178143950 TCAATTTCTTCATCTGTAAATGG + Intergenic
969425656 4:7122376-7122398 ATGATGTCCTCACCTCTGAATGG + Intergenic
971868402 4:32203702-32203724 ATGATGTCATCACCTCTAAAAGG - Intergenic
973264646 4:48199065-48199087 TCAGTTTCTTCACCTGTAAAAGG - Intronic
977170810 4:93760038-93760060 TCAATCTCCTCACCTGTAAAAGG + Intronic
979818240 4:125137793-125137815 TCCATTTCTTCATCTGTAAATGG + Intergenic
980234762 4:130090762-130090784 TAGCTGGCTTCACCTCTCAATGG - Intergenic
980777353 4:137453850-137453872 TCCATGTTTTCACCTGTAAATGG + Intergenic
982694250 4:158581703-158581725 TCAATGTCTCCATCTTTAAAGGG - Intronic
984412661 4:179414548-179414570 TCAATGTGTGCACCTTTAAAAGG + Intergenic
985867327 5:2524275-2524297 TCCCTGTCTTCTCCTCGAAAAGG + Intergenic
986487270 5:8250310-8250332 TCATTTTCTCCACCTCTAAATGG - Intergenic
986751929 5:10795027-10795049 CCAATGTCCTCACCTCAAAAGGG - Intergenic
988908694 5:35817337-35817359 TCTGTGTCCTCACCTGTAAAGGG - Intergenic
992936418 5:81711873-81711895 TCGGTTTCCTCACCTGTAAAGGG + Intronic
995554951 5:113318213-113318235 TAGTTGTCTTCATCTCAAAATGG - Intronic
998371008 5:141661425-141661447 TCAATTTCTTCATTTCTAAAAGG - Intronic
999218951 5:149959449-149959471 TCAATGTTTTCACCTTTCAAAGG - Intergenic
999351724 5:150877623-150877645 TTGATTTCTTCATCTTTAAAAGG - Intronic
1000861427 5:166460535-166460557 TTGATACCTTCACCTGTAAATGG + Intergenic
1001376506 5:171264524-171264546 TCAGTGTCCTCACCTGTAAATGG + Intronic
1001552776 5:172616726-172616748 TCAATGTCTTCATCTATAAAAGG + Intergenic
1001727696 5:173920639-173920661 TCAATTTCCTCACCTGTAAACGG + Intronic
1002584783 5:180237628-180237650 TCAATTTCTTCATCTGTAAATGG + Intronic
1002782595 6:379048-379070 TCCATGTGTTCCTCTCTAAATGG + Intergenic
1003357582 6:5388484-5388506 TCTATGTCTTTGCCTCTAGATGG + Intronic
1006236464 6:32637516-32637538 ACAATGTCTTCACCTCCACAGGG - Exonic
1006246497 6:32741501-32741523 ACAATGTCTTCACCTCCACAGGG - Exonic
1006841240 6:37029124-37029146 TCGGTGTCTTCATCTGGAAATGG - Intergenic
1007454681 6:41967450-41967472 TCGATTTCTTCATCTATAAAAGG + Intronic
1008483567 6:52011216-52011238 TCCATGTCCTCACCTCTAGATGG - Intronic
1008612774 6:53199509-53199531 TCGATTGCTTCATCTGTAAAGGG + Intergenic
1009469600 6:64016343-64016365 TCAATTTCCTCACCTATAAATGG - Intronic
1010602331 6:77845093-77845115 TCGATGTCTTCAGCTTTATGTGG + Intronic
1012348735 6:98224944-98224966 TGCATGTTTTCACCTGTAAATGG + Intergenic
1019838016 7:3410002-3410024 TCAATGTCCTCACCTGTAAAAGG + Intronic
1020442465 7:8233038-8233060 TCACTGTCTCCACCTCTAAAAGG - Intronic
1021790418 7:24199160-24199182 TCGGTGTCCTCACCTGTGAATGG + Intergenic
1022266288 7:28758156-28758178 TCGATATCTTCATGTCTGAAAGG - Intronic
1022404020 7:30069792-30069814 TCCATGTCTTCATTTCTAAAAGG + Intronic
1022581231 7:31557021-31557043 TCTATGACTTCATCTCTACATGG + Intronic
1022800414 7:33771613-33771635 TCATTGTCTTCACCTTAAAATGG + Intergenic
1024172089 7:46800018-46800040 GAGATGTCTTCAACTGTAAATGG + Intergenic
1025709720 7:63897608-63897630 TTAATGTCTTCAGATCTAAAGGG + Intergenic
1026467830 7:70669704-70669726 ACGATGACTTCAACTCTCAAAGG - Intronic
1033253539 7:139779482-139779504 TCCATTTCTTCAACTCTAAAAGG - Intronic
1034444899 7:151108830-151108852 TCAATGCCCTCATCTCTAAAAGG + Intronic
1037543110 8:19890843-19890865 TGGGTGTCTGCACCACTAAACGG + Intergenic
1038910144 8:31954239-31954261 TCAGTGTCTTCACCTCTAAATGG - Intronic
1038967089 8:32586713-32586735 TCCATCTCCTCACCTGTAAATGG + Intronic
1041475569 8:58261233-58261255 TCAATGTCTTCATCTATAAATGG + Intergenic
1042876485 8:73444965-73444987 TCGCACTCTTCACCTCTAGAAGG + Intronic
1044484478 8:92735008-92735030 AGGGTGTCTGCACCTCTAAATGG + Intergenic
1045723039 8:105136567-105136589 TCAGTTTCTTCATCTCTAAATGG + Intronic
1046548342 8:115680380-115680402 TCAATTTCCTCACCTCAAAATGG - Intronic
1046706874 8:117463945-117463967 TCCATTTCTCCATCTCTAAAGGG + Intergenic
1047340891 8:123979405-123979427 TCAGTTTCCTCACCTCTAAAAGG - Intronic
1047430043 8:124783180-124783202 TTGGTGTCTTCATCTGTAAAAGG - Intergenic
1047512909 8:125529213-125529235 TCAATTTCCTCACCTGTAAAAGG - Intergenic
1048324451 8:133428398-133428420 TCAATGTTCTCATCTCTAAAAGG - Intergenic
1048805404 8:138236625-138236647 TCAATGTCTTCATTTGTAAAAGG + Intronic
1050276770 9:4008828-4008850 TCCATTTCCTCACCTATAAAAGG - Intronic
1050494968 9:6230930-6230952 ACTATTTCTTCACTTCTAAAAGG + Intronic
1050662485 9:7898260-7898282 TCTATTTCTTCATCTGTAAAGGG - Intergenic
1052031223 9:23631075-23631097 TCAGTTTCTTCACCTGTAAATGG + Intergenic
1052273097 9:26647991-26648013 TCAATGTCCTCATCTGTAAAAGG + Intergenic
1052954125 9:34239705-34239727 TCAATTTCTTCATCTGTAAAGGG + Intronic
1055230518 9:74058662-74058684 TCTATGTCTTCACCTCTTATAGG + Intergenic
1059335143 9:113564462-113564484 TCGGTTTCTTCATCTGTAAAAGG - Intronic
1059596091 9:115722309-115722331 TCAGTTTCTTCATCTCTAAAAGG + Intergenic
1059725505 9:117004577-117004599 AGGATTTCTTCACCTCTCAATGG - Intronic
1061309086 9:129750763-129750785 TCAGTGTCCTCACCTGTAAACGG - Intronic
1186119672 X:6346457-6346479 TGGATGTCATCACCTCAAATTGG - Intergenic
1188474897 X:30581401-30581423 TCGATATCTGTGCCTCTAAATGG + Intergenic
1191702343 X:64056183-64056205 TTGATCTCTTCACCTCTTGAAGG + Intergenic
1195402019 X:104471290-104471312 TCCATGTGCTCACCTCAAAAAGG - Intergenic
1195968534 X:110450834-110450856 ACCATGTCTGCACCTCTAATGGG + Exonic
1196331809 X:114479796-114479818 TGGATGTCTTCACCTACACAGGG + Intergenic
1196562774 X:117170469-117170491 TCAATTTCTTCATCTGTAAATGG - Intergenic
1197140100 X:123108316-123108338 TCAGTTTCTTCACCTGTAAAGGG + Intergenic
1198017168 X:132623140-132623162 TCAGTTTCTTCACCTATAAATGG - Intergenic
1198448400 X:136741279-136741301 TCATTGTCTTCACGTATAAATGG - Intronic
1198604970 X:138327302-138327324 TCTATTACTTCATCTCTAAACGG - Intergenic
1198909410 X:141596293-141596315 TTAATGTCTTCACCATTAAATGG - Intronic
1199065832 X:143417363-143417385 ATGAAGTCTTTACCTCTAAAAGG - Intergenic
1199397668 X:147358678-147358700 TCAATGTCTTCCCATCTACAAGG + Intergenic
1200139271 X:153890483-153890505 TAGCTGGCTTCACCTCTCAAAGG + Intronic