ID: 1155295523

View in Genome Browser
Species Human (GRCh38)
Location 18:24381187-24381209
Sequence TGGGATTATAGCCAAGGAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 5, 3: 20, 4: 183}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155295518_1155295523 29 Left 1155295518 18:24381135-24381157 CCTGCAGTGGGGAAGAGAGCTTG 0: 1
1: 0
2: 2
3: 30
4: 253
Right 1155295523 18:24381187-24381209 TGGGATTATAGCCAAGGAGTAGG 0: 1
1: 0
2: 5
3: 20
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155295523 Original CRISPR TGGGATTATAGCCAAGGAGT AGG Intronic
901014880 1:6223035-6223057 TGGGACTCTAGCCAAGGCGGTGG - Exonic
902449557 1:16488244-16488266 TGGGATTACAGGCAAAGTGTGGG - Intergenic
906317087 1:44793390-44793412 TGACAATATAGCCAGGGAGTGGG - Intergenic
906491305 1:46270878-46270900 TGGGATTCTAGGAAGGGAGTGGG + Intronic
906665078 1:47615746-47615768 GGGAATTATAGCCAAGGAGCAGG + Intergenic
910719681 1:90272387-90272409 GGGATTTATAGCCAAGGAGAAGG - Intergenic
911170759 1:94768899-94768921 TGAGATTCTAGCCAGGGTGTAGG - Intergenic
911238624 1:95439846-95439868 GAGGATAATAGCTAAGGAGTGGG - Intergenic
911994203 1:104742881-104742903 TGGTATTATAGAGAAAGAGTTGG - Intergenic
915609226 1:156977810-156977832 TTGGAATAAAGTCAAGGAGTGGG - Intronic
917733569 1:177900382-177900404 TGGGATTACAGCCACTGGGTTGG - Intergenic
917738414 1:177940582-177940604 TGGGATTGGAGCCAGGGCGTTGG - Intronic
917939037 1:179898638-179898660 TGGGATTACAGGCTAGGAGATGG + Intronic
918428507 1:184434910-184434932 TGGGTTTTGAGCCAGGGAGTGGG + Intronic
918462466 1:184790441-184790463 TGAGATTATAGACAAGATGTAGG + Intergenic
919584987 1:199426185-199426207 TGGGCTTATGGCCAAGTACTGGG - Intergenic
922014829 1:221634704-221634726 TGGATTTATAGCCAAGGAGAAGG + Intergenic
922346675 1:224702341-224702363 TGGGCTTATATCCCAGGAGTGGG + Intronic
923458268 1:234185220-234185242 TAGGATTAGAGCCAAGGAGAAGG + Intronic
1064458128 10:15507672-15507694 GGGGATTATAGACAAAGAGTAGG - Intergenic
1065126982 10:22583469-22583491 TGGGATCCAAGCCAAGGTGTTGG + Intronic
1065424646 10:25586961-25586983 AGGTACTATAGCCAAGGAGCTGG + Intronic
1067217328 10:44314013-44314035 TGGGATTGTTGCCAAGGCTTTGG - Intergenic
1068359145 10:55953236-55953258 AGGGATTATAGTTAAGAAGTTGG + Intergenic
1068719179 10:60223300-60223322 GGAATTTATAGCCAAGGAGTAGG - Intronic
1070825880 10:79390531-79390553 TGGGGTCATGGCCAAGGAGGGGG - Intronic
1071651152 10:87394249-87394271 GGGAATTATAGTCAAGGAGGAGG - Intergenic
1073291394 10:102414957-102414979 TGGGATGAGGGCCAGGGAGTGGG + Exonic
1073294443 10:102430521-102430543 TGGGTTTTTAGCCAAGGCCTGGG + Intronic
1074203499 10:111260184-111260206 CGGGAAAATAGCCAAGGAGGTGG - Intergenic
1075478541 10:122757925-122757947 TGAGGTTATAGTCAAGCAGTCGG + Intergenic
1077731844 11:4739511-4739533 TGGGATTCTAGCCAATGCCTAGG - Intronic
1079109874 11:17599333-17599355 CAGGATTAGAACCAAGGAGTGGG - Intronic
1079915461 11:26364300-26364322 TGTTATTAAATCCAAGGAGTAGG - Intronic
1087112442 11:94485116-94485138 TGGGATTACAGGCGAGTAGTTGG - Intronic
1087403835 11:97703530-97703552 GGAATTTATAGCCAAGGAGTAGG - Intergenic
1087422557 11:97948795-97948817 TTGTGTTATAGCCAAGGAGATGG + Intergenic
1087577292 11:100005058-100005080 GGGGATTAAAGCCTAAGAGTGGG - Intronic
1089773760 11:120821634-120821656 TGGAATTAGACCCAAGGAGCTGG + Intronic
1091890024 12:4046048-4046070 AGGGAACATAGCCAAGGAGTGGG - Intergenic
1093331989 12:17855169-17855191 TTGGAATTTAGCCAAGGACTGGG - Intergenic
1094809002 12:34119704-34119726 TGGGTTAATAGACAAGGAGCAGG - Intergenic
1095367488 12:41425340-41425362 TGGAAGTATAGCCAAGGAGTAGG + Intronic
1097853153 12:64434100-64434122 TGGGAGGATAGCCCAGGAGGTGG - Intronic
1098047691 12:66418930-66418952 TGGGTATATACCCAAGCAGTGGG - Intronic
1098834629 12:75407160-75407182 GGGATTTATAGCCATGGAGTAGG - Intronic
1101822190 12:108192619-108192641 TGGGAACACAGCCAAGCAGTGGG - Intronic
1103057412 12:117832775-117832797 TGGCTTCATAGCCTAGGAGTAGG - Intronic
1106023498 13:25936325-25936347 GGGGATTATAGGGAAGGATTCGG + Intronic
1106032330 13:26014331-26014353 TGGTGCTATAGCCAAGGAGGTGG + Intronic
1106454652 13:29916527-29916549 TGGGAACAGGGCCAAGGAGTGGG - Intergenic
1106569198 13:30911597-30911619 TGGGGTTATAGCCACGTACTGGG - Intronic
1108824492 13:54395765-54395787 TGGATTTATAGCCAAGGAGTGGG + Intergenic
1109640912 13:65190536-65190558 TGGGATTATTGCTAAGGAGGAGG + Intergenic
1111427219 13:88102778-88102800 GGGATTTATAGCCAAGGAGAAGG + Intergenic
1111525095 13:89458214-89458236 TTGGATTACTGCCAAGCAGTAGG - Intergenic
1114552304 14:23539800-23539822 AGGGAATATCACCAAGGAGTTGG + Intronic
1118065928 14:62190069-62190091 GGGATTTATAGCCAAGGAGCAGG - Intergenic
1119765223 14:77183542-77183564 TGTGAGCATAGCCAGGGAGTGGG + Intronic
1120965932 14:90167770-90167792 TGGGATTATTGGCAGGGGGTGGG - Intronic
1121263256 14:92581850-92581872 GGGGGTTATAGCCAAGGAGCAGG + Intronic
1121333552 14:93063108-93063130 TGAGCTAATGGCCAAGGAGTGGG - Intronic
1121373617 14:93384201-93384223 TGGGTATATACCTAAGGAGTGGG + Intronic
1124993986 15:34704760-34704782 AGAGATTACAGCCAAGGAGAAGG - Intergenic
1127086057 15:55425420-55425442 GGGGTTTATAGCCAAGGAGTAGG - Intronic
1129491018 15:75925810-75925832 GGGATTTATAGCCAAGGAGGAGG + Intronic
1130006874 15:80107973-80107995 TGGGATTCAACCCAAGCAGTTGG - Intronic
1130212488 15:81937861-81937883 GGGAATTGTAGCCCAGGAGTAGG + Intergenic
1133028090 16:2997336-2997358 TGGGATTCTAGCTAAGGAGAGGG - Intergenic
1136665540 16:31808665-31808687 AGAGAGTATAACCAAGGAGTTGG + Intergenic
1139581490 16:67876521-67876543 TGGGATTTTGGCCAAGGAGGTGG + Exonic
1140790366 16:78385568-78385590 TTGGATTAGAGCCCAGGACTTGG + Intronic
1144120511 17:12148122-12148144 TGGGATTTTAAGCAAGGAGATGG + Intergenic
1144344866 17:14340417-14340439 GGGGTTTAGAGCCAAGGAGCAGG - Intronic
1144588245 17:16501989-16502011 GGAGTTTATAGCCAAGGAGCAGG - Intergenic
1146928523 17:36761833-36761855 CGGGATTAGAGCTAATGAGTTGG + Intergenic
1147999977 17:44382030-44382052 TGGGATTATAGCATAACAGTGGG - Intronic
1153598538 18:6755036-6755058 TGGGATTACAGACAAGTAGCTGG - Intronic
1153614674 18:6923543-6923565 GGGGTTTCTAGCCAAGGAGCAGG - Intergenic
1155210023 18:23592668-23592690 TGAGGTTATGGCCAAGAAGTTGG + Intergenic
1155295523 18:24381187-24381209 TGGGATTATAGCCAAGGAGTAGG + Intronic
1155602180 18:27562367-27562389 GAGATTTATAGCCAAGGAGTAGG + Intergenic
1156219711 18:35038958-35038980 TGGGATGATGGCCAAGAATTTGG - Intronic
1156526085 18:37768583-37768605 GGGATTTATAGCCAAGGAGCAGG - Intergenic
1157086246 18:44582945-44582967 TGGGGTTACAACCAAAGAGTCGG + Intergenic
1157791637 18:50537151-50537173 TGTGATTATTTTCAAGGAGTTGG - Intergenic
1158212194 18:55064496-55064518 AGGGATGAAAGCCAAGGACTTGG - Intergenic
1158956793 18:62547826-62547848 TGGGATTACAGACATGGTGTGGG + Intronic
1165553737 19:36611036-36611058 TGGGATTACAGCCAAGGCCAAGG + Intronic
1167065136 19:47179677-47179699 TGGGATTATAGGCAAGTAGCAGG + Intronic
925811181 2:7702437-7702459 TGGAATTCTAGGCCAGGAGTTGG + Intergenic
927825291 2:26304710-26304732 TGAGTTGATAGACAAGGAGTAGG + Intergenic
928114363 2:28536563-28536585 TGGGATTTAAACCAAGGAATGGG - Intronic
930444500 2:51452659-51452681 GGAATTTATAGCCAAGGAGTAGG - Intergenic
931057190 2:58485820-58485842 GGAGTTTATAGACAAGGAGTAGG + Intergenic
931058862 2:58503900-58503922 GGGGATTGTAGACAAGGAGCAGG + Intergenic
931796410 2:65714141-65714163 TGGGTTTAAAGCCAAGTATTTGG - Intergenic
931989127 2:67771891-67771913 TGGGATTATGGCCCAAAAGTAGG + Intergenic
932252918 2:70259777-70259799 TGGAATTACAGCCATGGGGTGGG + Intronic
933758115 2:85656458-85656480 AGGGATTATAGCCCAAGAGGAGG - Intergenic
937249125 2:120512204-120512226 TGGCATTCTGGCCAAGGAGTTGG + Intergenic
937667140 2:124500402-124500424 GGGATTTATAGCCAAGGAGTAGG + Intronic
938583094 2:132665578-132665600 TGGTATTACAGCAAAGGTGTTGG + Intronic
938652530 2:133398739-133398761 TGGGAGCATAGCCAAGCAGATGG + Intronic
938958260 2:136318503-136318525 GAGGATAATAGGCAAGGAGTGGG + Intergenic
938991573 2:136635262-136635284 TGGGATTACAGTCAAGATGTTGG + Intergenic
943002637 2:182348117-182348139 TGTGATTATAGCCAAGTAGTAGG - Intronic
1170080048 20:12464657-12464679 TGGGAAAATAGACAAGGAGTTGG - Intergenic
1170233986 20:14081281-14081303 GGGATTTATAGCCAAGGAGCAGG - Intronic
1171279582 20:23884413-23884435 GGGATTTATAGCCAAGGAGCAGG - Intergenic
1174075700 20:47934472-47934494 TGGGTTTATAGCCAAGGAGCAGG + Intergenic
1174354125 20:49987188-49987210 TGGGATTACAGCGCAGGAGGTGG + Intronic
1180111345 21:45655447-45655469 TTTGATTATAGCCATGTAGTGGG + Intronic
1181538460 22:23560231-23560253 TGGGATAAATGCCCAGGAGTAGG - Intergenic
1181598214 22:23932136-23932158 TGGGTTTGTAGCCTAGGAGCAGG + Intergenic
1181666319 22:24400571-24400593 TTGAAGTATAGACAAGGAGTGGG + Intronic
1182192774 22:28480373-28480395 TGAGATTAGCGCCAAGAAGTTGG - Intronic
1185405292 22:50644741-50644763 GGAGTTTATAGCCAAGGAGCAGG - Intergenic
950007530 3:9701072-9701094 TGGGATTACAGCCAAGGCTGAGG + Intronic
950794772 3:15501851-15501873 GGGAATTATAGCCAAGAAGCAGG - Intronic
952449430 3:33417808-33417830 TGGGAGTATGGACAAGGTGTTGG - Intronic
953460624 3:43079028-43079050 TGGGATAAAAGCCTAGAAGTAGG - Intergenic
957521046 3:81318981-81319003 TGTGATTCTAGGCAAGGACTGGG + Intergenic
959770565 3:110090314-110090336 GGGATTTATAGCCAAGGAGCAGG + Intergenic
960663734 3:120089506-120089528 GGTGATTAAAGCCAAAGAGTAGG - Intronic
965852565 3:173047404-173047426 TGTGATTATAACCATGGAGAAGG + Intronic
969800417 4:9560063-9560085 AGGTATCATAGCCAAGGAGAGGG + Intergenic
970335490 4:15036074-15036096 TGGGATAAAAGCCAGGAAGTTGG + Intronic
971402423 4:26288258-26288280 AGGGATTGTAGTCAAGAAGTTGG + Intronic
972228580 4:37043743-37043765 GGGATTTATAGCCAAGGAGCAGG + Intergenic
972753908 4:42024234-42024256 TGGGATTACAGGCAAGTAGCTGG - Intronic
973209953 4:47604692-47604714 TAGGATTATAGCCATGGAGGAGG - Intronic
974329330 4:60456668-60456690 TGGGATGATAGCCCAAGCGTTGG - Intergenic
977485988 4:97647483-97647505 GGGGATTCTAGCAAAGGAGGAGG - Intronic
977856043 4:101894607-101894629 GGTGATTATAGCTAAGGAGGTGG - Intronic
978036045 4:103996257-103996279 CAGGAGTATAGCCAGGGAGTTGG + Intergenic
979921936 4:126508315-126508337 TGGTATTATAGCCAATGCTTTGG + Intergenic
981932668 4:150207947-150207969 GGGGATTATAACCAAGGAGCAGG + Intronic
984500137 4:180548056-180548078 TGGGCTTTTAGCCAAGATGTAGG - Intergenic
984769174 4:183422681-183422703 TGGTATCACAGCCAAGCAGTTGG - Intergenic
985036535 4:185846036-185846058 TTGGATAAATGCCAAGGAGTTGG - Intronic
985354446 4:189102763-189102785 TGGGAGGAGAGCCAAGGAGGGGG - Intergenic
986452770 5:7882539-7882561 TAGGAATATAGAAAAGGAGTAGG + Intronic
988135865 5:27171044-27171066 TGAGTTTATAGCCAAGAAGCTGG - Intergenic
989595165 5:43149870-43149892 TGGGATTATTGTCAAGAAGGGGG + Intronic
990257950 5:53991045-53991067 TGGAATTATACCCATGGGGTGGG - Intronic
991722262 5:69504818-69504840 TGGGATTACAGGCAAGTAGCTGG - Intronic
998017178 5:138741653-138741675 TGTCATTAAAGCCAAGGACTTGG - Intronic
1000594145 5:163194526-163194548 GATGATTATAGCCAAGGAGCAGG - Intergenic
1001117621 5:168952889-168952911 GGGGTTTATAGCCAAAGAGCAGG + Intronic
1002104902 5:176875188-176875210 GGCGATTAAAGCCATGGAGTGGG - Intronic
1002272573 5:178082275-178082297 GGGGGTGATAGCCAAGGAGCAGG - Intergenic
1002449723 5:179311762-179311784 GGGGGTGATAGCCAAGGAGCAGG - Intronic
1003075770 6:2982668-2982690 GGGATTTATAGCCAAGGAGCAGG - Intergenic
1004450757 6:15743530-15743552 GAGATTTATAGCCAAGGAGTTGG - Intergenic
1004909271 6:20267662-20267684 TGGGAAAATAGCCCAGGAGAAGG - Intergenic
1005031586 6:21513659-21513681 TGGGAAGTTTGCCAAGGAGTTGG + Intergenic
1008806935 6:55441127-55441149 AGAATTTATAGCCAAGGAGTGGG + Intronic
1009380787 6:63026288-63026310 TGGATTTATAACCAAGGAGCAGG + Intergenic
1011053312 6:83177936-83177958 GGGCTTTATAGCCAAGGAGCAGG - Intronic
1013664709 6:112335555-112335577 TGGGATAATGGCCAAGGTGGTGG + Intergenic
1013744555 6:113329983-113330005 GGAATTTATAGCCAAGGAGTAGG - Intergenic
1015978829 6:138818691-138818713 TGGGCGGATAGCCAAGGAGCAGG + Intronic
1016647658 6:146428356-146428378 TGGGATTATTTCTCAGGAGTAGG - Intronic
1017574133 6:155782610-155782632 GGGATTTATAGCCAAGGAGCAGG - Intergenic
1019744625 7:2692737-2692759 TGGGCTTGTGGCCAAGGGGTGGG - Intronic
1021212488 7:17871691-17871713 GGGATTTATAGCCAAGGAGCAGG - Intronic
1022785111 7:33630936-33630958 TGGGATTACAGCCAAGTGGGGGG + Intergenic
1023040099 7:36165314-36165336 TAGGTTTATAGCCTAGGAGTAGG + Intronic
1023476024 7:40578660-40578682 TGAGAATATAGCCAAGGCATTGG + Intronic
1027620992 7:80484843-80484865 AGGACCTATAGCCAAGGAGTAGG - Intronic
1030626790 7:111853679-111853701 TGGGATTAAAGCCAGTGGGTGGG - Intronic
1031328179 7:120429002-120429024 TGGGATAATTGTCAAGAAGTTGG + Intronic
1032264474 7:130361474-130361496 TGGGAGGATGGCTAAGGAGTTGG + Intronic
1034394033 7:150806411-150806433 TGGGGGTTTATCCAAGGAGTGGG - Intergenic
1036436907 8:8743090-8743112 GGGGTTTAGTGCCAAGGAGTGGG - Intergenic
1036690722 8:10943132-10943154 TGGGATCATAGCTCAGGAGCAGG + Intronic
1037448861 8:18996822-18996844 TGGGATTATAGTGTAGTAGTGGG - Intronic
1040852998 8:51921446-51921468 GGAGTTGATAGCCAAGGAGTAGG + Intergenic
1044417525 8:91953172-91953194 TGGTATTATCGCCAAGTAATTGG + Intergenic
1044623504 8:94213910-94213932 TGGGATTGGGCCCAAGGAGTTGG - Intronic
1045738055 8:105319011-105319033 TGGGATTATTGCCCAGGAGCGGG + Intronic
1045744285 8:105399105-105399127 TGAGTTTATCTCCAAGGAGTAGG + Intronic
1045858235 8:106789150-106789172 TGGGACTATTGCCAAGGAATGGG + Intergenic
1046190737 8:110791153-110791175 TGGGTTCACAGCCAAGGATTGGG - Intergenic
1046280143 8:112017747-112017769 TTGGTTTATAGCCAAGCATTTGG - Intergenic
1047146601 8:122207228-122207250 TAGAATCAAAGCCAAGGAGTAGG + Intergenic
1049297398 8:141850066-141850088 GGGGATTACAGCCGAGGAGCAGG + Intergenic
1051148338 9:14053990-14054012 TGGCATTATAACCAAGATGTTGG + Intergenic
1053097924 9:35345315-35345337 TGGGAATTTAGCCAAGGAGCAGG + Intronic
1055953818 9:81755468-81755490 GGGACTTATAGCCAAGGAGCAGG - Intergenic
1056238617 9:84621020-84621042 TGGGATTTGAACCAGGGAGTGGG + Intergenic
1056740375 9:89249481-89249503 GGAGTTTATAGCCAAGGAGCAGG + Intergenic
1057113396 9:92497104-92497126 TGGGATAAAATCCTAGGAGTGGG - Intronic
1058186400 9:101860545-101860567 TGGATTTATAGTTAAGGAGTAGG - Intergenic
1060043528 9:120322416-120322438 TGGGTTTAGAGCCCAGGAGAAGG - Intergenic
1060128548 9:121074086-121074108 TAGGATTATAGTCAAGGATGGGG + Intergenic
1061202274 9:129144761-129144783 TGGGATTACAGGCAAAGACTTGG - Intronic
1186836784 X:13446311-13446333 AGGGATCAGAGCCAAGCAGTGGG - Intergenic
1188281991 X:28281466-28281488 TGGGATTACAGGCATGAAGTAGG - Intergenic
1189289883 X:39877546-39877568 TGGGATTACAGACATGCAGTCGG + Intergenic
1189526238 X:41824931-41824953 AGGAATTATTGCCAAGGGGTTGG - Intronic
1190182497 X:48205031-48205053 GGGATTTATAGTCAAGGAGTAGG + Intronic
1193122221 X:77835576-77835598 TGGGTGTATACCCAAGCAGTGGG - Intronic
1195573055 X:106417912-106417934 TGGGCGTAAAGCCAAGGACTTGG + Intergenic
1196860477 X:120022919-120022941 TGGGATTATAGTTGAGGACTAGG - Intergenic
1197449034 X:126588323-126588345 TGAAATTATAGTCAAGGAGCAGG - Intergenic
1200403585 Y:2785347-2785369 GGGATTTATAGCCAAGGAGCAGG + Intergenic
1201470582 Y:14329815-14329837 TGGGATGGGAACCAAGGAGTGGG - Intergenic