ID: 1155297362

View in Genome Browser
Species Human (GRCh38)
Location 18:24397675-24397697
Sequence GGCCACCGCCTCGGGAGCTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 238}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155297362_1155297372 16 Left 1155297362 18:24397675-24397697 CCAGAGCTCCCGAGGCGGTGGCC 0: 1
1: 0
2: 0
3: 14
4: 238
Right 1155297372 18:24397714-24397736 CGTCCGCCCGCCCCACGTCGAGG 0: 1
1: 0
2: 0
3: 6
4: 83
1155297362_1155297375 22 Left 1155297362 18:24397675-24397697 CCAGAGCTCCCGAGGCGGTGGCC 0: 1
1: 0
2: 0
3: 14
4: 238
Right 1155297375 18:24397720-24397742 CCCGCCCCACGTCGAGGAAGTGG 0: 1
1: 0
2: 0
3: 4
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155297362 Original CRISPR GGCCACCGCCTCGGGAGCTC TGG (reversed) Exonic
900001368 1:16695-16717 GGCCAGCACCTCAGGAGCTGGGG + Intergenic
900021088 1:187217-187239 GGCCAGCACCTCAGGAGCTGGGG + Intergenic
900694356 1:4000675-4000697 GGGCACTGGCTCGGGTGCTCTGG + Intergenic
903504720 1:23825325-23825347 GGCCGCCGCCTCGGCGGCTCGGG + Intronic
906507468 1:46390844-46390866 CGCCACCATCTTGGGAGCTCTGG - Intergenic
907504900 1:54911031-54911053 CGCCACCATCTTGGGAGCTCTGG - Intergenic
907506020 1:54918816-54918838 CGCCACCATCTTGGGAGCTCTGG - Intergenic
910116616 1:83738847-83738869 CGCCACCATCTTGGGAGCTCTGG - Intergenic
910963542 1:92785485-92785507 GGCCACCTCTGGGGGAGCTCGGG - Intronic
918180838 1:182085147-182085169 GGACACCGCCTCTCTAGCTCTGG + Intergenic
919931737 1:202225554-202225576 CCCCACCTCCTGGGGAGCTCTGG - Intronic
920639793 1:207741177-207741199 CGCCACCATCTTGGGAGCTCTGG - Intergenic
921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG + Exonic
921384081 1:214551865-214551887 CGCCTCCAGCTCGGGAGCTCGGG - Intronic
922007876 1:221550696-221550718 CGCCACCATCTTGGGAGCTCTGG - Intergenic
1064257095 10:13751551-13751573 GGCCACAGCCTTGCAAGCTCTGG - Intronic
1065323578 10:24531121-24531143 GGCCTCAGCCTCCGGGGCTCAGG - Intronic
1066312873 10:34214564-34214586 TTCCACCACTTCGGGAGCTCAGG + Intronic
1071327357 10:84530333-84530355 TGCCACCATCTTGGGAGCTCTGG - Intergenic
1073076484 10:100828051-100828073 GGCACCCGCCTCGGACGCTCGGG + Exonic
1077273293 11:1691836-1691858 AGCCACTGCCTCAGGAGGTCAGG + Intergenic
1077296873 11:1830480-1830502 AGCCACCGTCTCGGGGCCTCGGG + Intronic
1077523227 11:3048728-3048750 GGCCACAGCCTCAGGAGGACTGG + Intronic
1079375326 11:19887110-19887132 GGCCACCTCCCCTGGAGCTCTGG + Intronic
1079601683 11:22317600-22317622 TGCCACCATCTTGGGAGCTCTGG - Intergenic
1084356696 11:68643683-68643705 ACCCACCGCCTGGGGAGCACTGG + Intergenic
1084639737 11:70418001-70418023 GGCCACAGCCTCTGCAGCCCTGG - Intronic
1084966590 11:72747767-72747789 GGCCAGGGCCACGGGGGCTCAGG + Intronic
1087105052 11:94400330-94400352 TGCCACCGCCGCAGAAGCTCTGG + Intronic
1088879868 11:113964848-113964870 CGCCACCATCTTGGGAGCTCTGG + Intergenic
1091374457 12:16810-16832 GGCCAGCACCTCAGGAGCTGGGG + Intergenic
1092090759 12:5801983-5802005 GGGCACCCCCTCGAGAGCTATGG + Intronic
1093106604 12:15095121-15095143 CGCCACCATCTTGGGAGCTCTGG - Intergenic
1095552537 12:43459529-43459551 TGCCACCATCTTGGGAGCTCTGG + Intronic
1096351168 12:50902498-50902520 TGCCACCATCTTGGGAGCTCTGG - Intergenic
1096475615 12:51907284-51907306 GGCCAGCGACCCGGGAGCTGCGG + Intronic
1097281122 12:57846046-57846068 GTCCACCGCCTCCGGAGTTGGGG - Intronic
1103916958 12:124380665-124380687 AGCCACCGCCCGGGCAGCTCAGG - Intronic
1104602451 12:130162675-130162697 GGCCGCTGCGCCGGGAGCTCCGG + Exonic
1105304322 13:19158404-19158426 GGCCTTCACCTGGGGAGCTCTGG - Intergenic
1106140509 13:27007112-27007134 GGCCAGCGCCTGGGCTGCTCTGG + Intergenic
1107156373 13:37172075-37172097 CGCCACCATCTTGGGAGCTCTGG - Intergenic
1107467571 13:40664895-40664917 GGCCACCGCCTGCGGAGCGCCGG - Intronic
1110565576 13:76954705-76954727 GGCCACAGCAGAGGGAGCTCAGG + Intronic
1111709711 13:91795999-91796021 CGCCACCATCTTGGGAGCTCTGG - Intronic
1111820459 13:93207233-93207255 CGCCACCATCTCGGGAGCTCTGG + Intergenic
1112199175 13:97258843-97258865 GGCCACTGCCTCAAGGGCTCAGG + Intronic
1112290997 13:98143682-98143704 GGCCACCATCGCAGGAGCTCGGG + Intronic
1112580572 13:100674167-100674189 GGCCACCGGCCCGGGCGCCCGGG - Intronic
1112643727 13:101306167-101306189 GTCTGCAGCCTCGGGAGCTCTGG - Intronic
1113656015 13:112068157-112068179 GGCCAGCGCCTGGAGAGCCCAGG + Exonic
1113912779 13:113852083-113852105 CGCCAGAGCCTCGGGAGCACAGG - Intronic
1116740391 14:48747061-48747083 CGCCACCATCTTGGGAGCTCTGG + Intergenic
1119089874 14:71771854-71771876 CGCCACCATCTTGGGAGCTCTGG - Intergenic
1120397450 14:83985944-83985966 CGCCACCATCTTGGGAGCTCTGG + Intergenic
1121586879 14:95068673-95068695 GGCCACAGCCACGGCAGCACTGG - Intergenic
1122001065 14:98653871-98653893 TGCCACCATCTTGGGAGCTCTGG + Intergenic
1122401676 14:101471037-101471059 GCCCACCTCCTGGGGAACTCAGG + Intergenic
1123125522 14:105943228-105943250 TGCCACCATCTTGGGAGCTCTGG + Intergenic
1123158707 14:106256455-106256477 GGCCATCTCCTCGGGATCACAGG - Intergenic
1123189510 14:106555520-106555542 GGCCATCTCCTCGGGATCACAGG - Intergenic
1123215071 14:106801718-106801740 GGCCATCTCCTCGGGATCGCAGG - Intergenic
1202924785 14_KI270724v1_random:13851-13873 TGCCACCATCTTGGGAGCTCTGG - Intergenic
1126649788 15:50908935-50908957 GCCCGCCGGCCCGGGAGCTCAGG + Intronic
1126814270 15:52439224-52439246 TGCCACCATCTTGGGAGCTCTGG + Intronic
1127563374 15:60162739-60162761 GACCACCGACTCAGAAGCTCTGG + Intergenic
1127867187 15:63042501-63042523 GGCCGCCGCCTCGGCGGCTCGGG + Intergenic
1129776316 15:78238988-78239010 CGCCACCATCTTGGGAGCTCTGG - Intronic
1131174503 15:90201452-90201474 GGCCCCCGCCTCCGGACCTGGGG - Exonic
1131257379 15:90871552-90871574 GGCGACCGCCGCGGCGGCTCGGG - Intronic
1132452139 15:101974243-101974265 GGCCAGCACCTCAGGAGCTGGGG - Intergenic
1132454754 16:16378-16400 GGCCAGCACCTCAGGAGCTGGGG + Exonic
1132467335 16:83382-83404 GGCCAGGGTTTCGGGAGCTCTGG + Intronic
1132620837 16:867688-867710 GGCCACCCCACCGGGGGCTCTGG + Intronic
1135586857 16:23678433-23678455 GGACACTGACTCGGGAGGTCTGG + Intronic
1136867046 16:33767238-33767260 GCCGACCCCCTCGGGAGCCCGGG + Intergenic
1139637119 16:68264515-68264537 CGCCGCCGCCGCGGCAGCTCAGG - Intronic
1139903569 16:70346994-70347016 GGCCACCGACTCGTGGGCCCTGG + Exonic
1141103181 16:81212750-81212772 GGCCACAGCCTCAGGAACGCTGG + Intergenic
1141161201 16:81630339-81630361 GGCCACCGACTCATGAGCCCAGG + Intronic
1141605735 16:85152322-85152344 GGCCACCTCCACGTGAGCTGCGG + Intergenic
1141633901 16:85303717-85303739 GGCCGCCGCCTCCCGAGTTCTGG + Intergenic
1141685510 16:85567567-85567589 GACCACTGCCTTCGGAGCTCTGG - Intergenic
1142038058 16:87874657-87874679 TGACACAGCCTCGGGAGGTCCGG - Intergenic
1203105118 16_KI270728v1_random:1348965-1348987 GCCGACCCCCTCGGGAGCCCGGG - Intergenic
1203128396 16_KI270728v1_random:1613403-1613425 GCCGACCCCCTCGGGAGCCCGGG + Intergenic
1142488080 17:259698-259720 GGCCACCGCCACGGCGGCTGTGG - Intronic
1142766882 17:2069512-2069534 AGCCTCCGCCTCCAGAGCTCAGG - Intronic
1143148262 17:4790178-4790200 CGCCTCCGCCTCGGTGGCTCCGG - Exonic
1144371250 17:14593906-14593928 GACCACCTCCTCCGGAGCCCTGG - Intergenic
1145057432 17:19712766-19712788 GGCCACAGCCTGGTCAGCTCCGG - Intronic
1145957587 17:28865364-28865386 GGCCACAGCCACAGGATCTCTGG - Intergenic
1146750490 17:35373976-35373998 GGCCACCCCGTTGGGAGCGCAGG - Intergenic
1147015631 17:37489677-37489699 GGCTGCTGCCTCGGGAGCTAGGG + Intergenic
1147242347 17:39098847-39098869 GCCCTCTGCCTGGGGAGCTCTGG - Intronic
1147591983 17:41689463-41689485 TAGCCCCGCCTCGGGAGCTCGGG + Intronic
1148909794 17:50935293-50935315 AACCCCCGTCTCGGGAGCTCAGG + Intergenic
1150326723 17:64263461-64263483 GGCCACCGCCCTTGGAGCTAGGG + Intergenic
1151102871 17:71575601-71575623 GGCCACAACCCCAGGAGCTCTGG + Intergenic
1151729778 17:75904490-75904512 AGCCACCGCCCGGGGAACTCGGG - Intronic
1151854387 17:76710749-76710771 GGCCGCCGGCTCGGGGGCGCAGG + Exonic
1152741327 17:82019762-82019784 GGCCAAGGCCTCGGGAGGGCGGG - Intronic
1153400832 18:4682386-4682408 CGCCACCATCTTGGGAGCTCTGG + Intergenic
1155297362 18:24397675-24397697 GGCCACCGCCTCGGGAGCTCTGG - Exonic
1155749181 18:29398879-29398901 AGCCACCATCTTGGGAGCTCTGG - Intergenic
1160027831 18:75233086-75233108 GGCCACAGCCTCAGCAGCTCTGG + Intronic
1160581923 18:79887947-79887969 GGCCACCGTCTCGGGCTCACAGG + Intronic
1160843133 19:1155301-1155323 GGCCACTGTCTCTGGAGCGCCGG - Intronic
1161013167 19:1969851-1969873 AGCCACGGCATCCGGAGCTCGGG + Exonic
1161399149 19:4059849-4059871 GGCCCCCGCCGGGGGTGCTCTGG - Intronic
1163002791 19:14379220-14379242 GGCCACCCCCACAGGAGCCCAGG + Intergenic
1163063958 19:14779519-14779541 GGCCACCCCCACAGGAGCCCGGG - Intergenic
1163282463 19:16325815-16325837 GGCCGCCGCCGCGGCAGCCCTGG + Exonic
1163692255 19:18744238-18744260 GGCGGCCGCTTGGGGAGCTCAGG - Intronic
1163810902 19:19430752-19430774 GGCCACTACCTGGGGAACTCCGG - Intronic
1163885907 19:19964623-19964645 GGTGACCGCCTCCGGAGCCCAGG + Intergenic
1164056931 19:21629836-21629858 TGCCACCATCTTGGGAGCTCTGG + Intergenic
1166984225 19:46649838-46649860 GCCCACCACCTCCGGAGCGCTGG + Exonic
1167071901 19:47226683-47226705 GCCCAGCGCCCCGGGGGCTCTGG - Exonic
1168282064 19:55311290-55311312 GGTCTCCGCCACGGGACCTCAGG + Intronic
925032471 2:661442-661464 GGGCCCAGCCTCGGCAGCTCCGG - Intergenic
927168583 2:20350324-20350346 GGCCGCCGCCTCGGGGGCGTGGG - Intronic
927811480 2:26182846-26182868 GGCCAGCCCCTCAGGAACTCAGG - Intronic
929542423 2:42832454-42832476 TGCCACCATCTTGGGAGCTCTGG + Intergenic
931279063 2:60772363-60772385 AGCCTCCACCTCGGGGGCTCAGG - Intronic
931371408 2:61666744-61666766 GGCCATCCCATGGGGAGCTCTGG - Intergenic
933175672 2:79169855-79169877 TGCCACCATCTTGGGAGCTCTGG - Intergenic
934650199 2:96086125-96086147 GGGCAGCGGCTCTGGAGCTCAGG - Intergenic
934661383 2:96145398-96145420 CGCCACCGCCACGAGAGCCCGGG - Exonic
936039047 2:109135274-109135296 GGCCACCGCCTCAGGAGAAAAGG - Intronic
936568356 2:113596719-113596741 GGCCAGCACCTCAGGAGCTGGGG - Intergenic
937987454 2:127644469-127644491 GGCCACCTCCTCAGCAGGTCTGG + Intronic
938118897 2:128620190-128620212 GGCACCGGCCTCGGGGGCTCTGG + Intergenic
939493104 2:142899947-142899969 TGCCACCATCTTGGGAGCTCTGG - Intronic
941104895 2:161341129-161341151 GGCCGCCGGCTCGGGGGCGCAGG + Intronic
947622723 2:231601099-231601121 AGCCAGCCCCGCGGGAGCTCTGG - Intergenic
947955857 2:234190116-234190138 TGCCACTGCCTGGGCAGCTCAGG + Intergenic
1169000391 20:2163919-2163941 GGCCAGAGCCTGGAGAGCTCTGG + Intronic
1170026113 20:11891136-11891158 GGCCAGCGCCTCTCGAGCCCGGG - Intronic
1171141782 20:22749807-22749829 GGCCACCCCATAGGGAGCTCTGG + Intergenic
1171186421 20:23127052-23127074 GACCCCTGCCTAGGGAGCTCAGG + Intergenic
1171420492 20:25014263-25014285 GGCCTCAGCCCCAGGAGCTCTGG + Intronic
1174571079 20:51501751-51501773 GCCCACCTCCACGAGAGCTCGGG + Intronic
1175760726 20:61560821-61560843 GGCCTTCGCAGCGGGAGCTCTGG + Intronic
1176070673 20:63224675-63224697 GGCCACAGCCACGGGAGGTGTGG + Intergenic
1179209722 21:39314214-39314236 GGCCCCCGCCCCAGGAGCGCGGG - Intronic
1180042279 21:45287043-45287065 GGGCGCAGCCTCGGGAGCCCAGG - Intronic
1181167672 22:20992242-20992264 GGGCACCTCCTCGGAAGCACAGG - Exonic
1183675949 22:39298918-39298940 AGCCACCGAGTCGGGTGCTCTGG + Intergenic
1184121979 22:42457552-42457574 GACCTCCGCCTCCGGGGCTCGGG + Intergenic
1184663711 22:45976941-45976963 CGCCACCGCCGCGTGAGCCCGGG + Exonic
1185384506 22:50525697-50525719 GGCCCCCGCCTCCGCAGCCCTGG + Intronic
952921657 3:38289441-38289463 CGCCACCATCTTGGGAGCTCTGG - Intronic
952922639 3:38296566-38296588 TGCCACCATCTTGGGAGCTCTGG - Intronic
953357142 3:42265239-42265261 GACCAGCGCCTCGGACGCTCCGG - Intronic
953505955 3:43485589-43485611 CGCCACCATCTTGGGAGCTCTGG + Intronic
956564300 3:70617823-70617845 TGCCACCATCTTGGGAGCTCGGG + Intergenic
957000446 3:74877603-74877625 TGCCACCATCTTGGGAGCTCTGG - Intergenic
957081454 3:75639273-75639295 TGCCACCATCTTGGGAGCTCTGG - Intergenic
957687101 3:83515655-83515677 TGCCACCGTCTTGGGAGCTCTGG + Intergenic
958016680 3:87945876-87945898 CGCCACCATCTTGGGAGCTCTGG - Intergenic
961104559 3:124230120-124230142 GGCCACATCCTTGGGAGCCCAGG - Intronic
961384824 3:126517559-126517581 GGCCAAGGCCTCGGGAGCACGGG + Intronic
961486286 3:127219327-127219349 GGGCACAGCCTGGAGAGCTCAGG + Intergenic
961676512 3:128570419-128570441 GACCACCGCCTCTGCAGCTGGGG + Intergenic
965342072 3:167503355-167503377 CGCCACCATCTTGGGAGCTCTGG - Intronic
966822423 3:183935615-183935637 TGCCTCAGCCTCTGGAGCTCTGG + Intronic
968199572 3:196740304-196740326 AGCCACCGCCCCAGGAGCTGCGG - Intronic
969392386 4:6900543-6900565 AGCCTCCGCCCCCGGAGCTCAGG - Intergenic
969477927 4:7431785-7431807 GGCCACCGCCCCAGGAACACAGG - Intronic
970195645 4:13547814-13547836 GGCGCCCCCCTCGGGAGCGCGGG - Intergenic
970456087 4:16226124-16226146 GCCCACAGCCTGGGGAGCCCCGG + Intronic
971349559 4:25843883-25843905 GGCCCTCGCCTCGGGAGCCTTGG + Intronic
972766716 4:42158230-42158252 TGCCACCATCTTGGGAGCTCTGG - Intergenic
973205009 4:47550508-47550530 CGCCACCATCTTGGGAGCTCTGG - Intronic
973230670 4:47836803-47836825 GGCGCCTGCCACGGGAGCTCAGG + Intronic
974190034 4:58493061-58493083 TGCCACCATCTTGGGAGCTCTGG - Intergenic
974487797 4:62526557-62526579 CGCCACCATCTTGGGAGCTCTGG - Intergenic
978909082 4:114044860-114044882 TGCCACCATCTTGGGAGCTCTGG + Intergenic
980443868 4:132882755-132882777 TGCCACCATCTTGGGAGCTCTGG + Intergenic
980463704 4:133149069-133149091 AGCCAGCGCCTCGGGACCTGCGG + Intergenic
981740812 4:147999774-147999796 GGTCACCATCTTGGGAGCTCTGG + Intronic
983777851 4:171630218-171630240 CGCCACCATCTTGGGAGCTCTGG + Intergenic
987855186 5:23411618-23411640 TGCCACCATCTTGGGAGCTCTGG + Intergenic
989717755 5:44483832-44483854 CGCCACCATCTTGGGAGCTCTGG + Intergenic
991290681 5:65031240-65031262 CGCCACCATCTTGGGAGCTCTGG + Intergenic
992690598 5:79236923-79236945 GGCCACTGCCTCTGCAACTCTGG + Exonic
993982393 5:94558251-94558273 CGCCACCATCTTGGGAGCTCTGG + Intronic
994245581 5:97471914-97471936 GGGCACAGCCTTGGCAGCTCAGG - Intergenic
996128340 5:119751909-119751931 CACCACCGTCTGGGGAGCTCTGG + Intergenic
998546080 5:143029045-143029067 GGCCACAGCCCAGGGAGCCCTGG + Intronic
998644376 5:144045892-144045914 TGCCACCATCTTGGGAGCTCTGG + Intergenic
998666022 5:144298275-144298297 TGCCACCATCTTGGGAGCTCTGG + Intronic
998957642 5:147453737-147453759 GGCAGCCGCCGCGGGAGCCCGGG - Intronic
999300046 5:150485658-150485680 GGTCACCGCCTCGGGGACGCCGG + Intergenic
1000037505 5:157460250-157460272 GGCCACCTGCTCCGGAGCTGGGG + Exonic
1002418029 5:179130887-179130909 TGCCACCGCCTCTGGGGCTGAGG - Intronic
1006834135 6:36986389-36986411 GGCCCCGGGCTCGGGAGCTGTGG + Intergenic
1007736600 6:43985874-43985896 GGCCACCCCCTCCTGAGCTCAGG + Intergenic
1008582715 6:52921177-52921199 TGCCACCATCTTGGGAGCTCTGG - Intergenic
1009702518 6:67202054-67202076 TGCCACCATCTTGGGAGCTCTGG + Intergenic
1011195067 6:84772964-84772986 GGGCTCCGCCGCGGGAGCCCGGG + Intergenic
1014243405 6:119041998-119042020 CGCCACCATCTTGGGAGCTCTGG + Intronic
1015994919 6:138987845-138987867 GGCCCCCTCCTCGCGACCTCCGG - Exonic
1019633957 7:2065535-2065557 GGCCACCTCCTCCGAAGCTGGGG - Intronic
1020906278 7:14067573-14067595 TGCCACCATCTTGGGAGCTCTGG + Intergenic
1021885279 7:25131590-25131612 TGCCACCATCTTGGGAGCTCTGG - Intergenic
1023094857 7:36650163-36650185 CACCACCGTCTTGGGAGCTCTGG + Intronic
1024921854 7:54565625-54565647 GGCCACTGCCTGGAGAGGTCAGG - Intronic
1028993449 7:97075153-97075175 TGCCACCATCTTGGGAGCTCTGG + Intergenic
1030336875 7:108337789-108337811 CGCCACCATCTTGGGAGCTCTGG + Intronic
1030431310 7:109452518-109452540 TGCCACCATCTTGGGAGCTCTGG + Intergenic
1030661210 7:112221373-112221395 TGCCACCATCTCGGGAGCTCTGG + Intronic
1031299634 7:120047827-120047849 TGCCACCATCTTGGGAGCTCTGG + Intergenic
1031742766 7:125455583-125455605 CGCCACCATCTTGGGAGCTCTGG - Intergenic
1032653905 7:133907025-133907047 AGCCACCATCTTGGGAGCTCTGG + Intronic
1033299992 7:140176911-140176933 GGCCACCGCCGCCGCCGCTCCGG + Exonic
1033597100 7:142866023-142866045 GGCGCCTGCCTCGGGAGCTGGGG + Exonic
1034964950 7:155385071-155385093 CGCCACCATCTTGGGAGCTCTGG - Intronic
1035179481 7:157078587-157078609 ATCCCCCGCCTCTGGAGCTCGGG - Intergenic
1035222337 7:157413620-157413642 GGGCACCGGCTCGCGGGCTCTGG - Intronic
1040276269 8:46015669-46015691 GGCCTCCTCCTCGGCAGCACAGG + Intergenic
1040768391 8:50943944-50943966 CGCCACCCTCTTGGGAGCTCTGG - Intergenic
1042188002 8:66156145-66156167 GGCCACCTCCTGGGCATCTCTGG - Intronic
1045657649 8:104403462-104403484 TGCCACCATCTTGGGAGCTCTGG + Intronic
1047499253 8:125429703-125429725 GCCCAGCGCCTGGGGAGCTCCGG - Intergenic
1047618372 8:126581661-126581683 CGCCACCATCTTGGGAGCTCTGG + Intergenic
1047904718 8:129460492-129460514 GGCCTGGGCCTCAGGAGCTCTGG + Intergenic
1048631544 8:136247986-136248008 TGCCACCATCTTGGGAGCTCTGG + Intergenic
1049557516 8:143290523-143290545 GGCCACAGCCTTGGGAGCCCAGG - Intronic
1049721068 8:144115837-144115859 TGCCACCTCCGCGGGAGCACTGG + Exonic
1049884174 9:16806-16828 GGCCAGCACCTCAGGAGCTGGGG + Intergenic
1050115991 9:2264247-2264269 CGCCACCATCTTGGGAGCTCTGG - Intergenic
1051699128 9:19801059-19801081 GGCCACCATCTTGGGAGCTCTGG - Intergenic
1051870137 9:21727624-21727646 GTCCACCATCTTGGGAGCTCTGG + Intergenic
1051970117 9:22877736-22877758 CGCCACCATCTTGGGAGCTCTGG - Intergenic
1055049266 9:71963293-71963315 TGCCACCATCTTGGGAGCTCTGG - Intronic
1055455755 9:76469946-76469968 TGCCACCATCTTGGGAGCTCTGG + Intronic
1057596119 9:96417654-96417676 CGCCGCCGCCTCGGGAGGTGAGG - Exonic
1057684503 9:97220957-97220979 GGCCCCCGCCTCAGGCGCTGCGG + Intergenic
1060557466 9:124515998-124516020 GCCCACCGCCTCGTGAGTCCAGG - Intergenic
1061516294 9:131092460-131092482 GGCCACGGCCTCAGGGTCTCTGG - Exonic
1187613878 X:20972193-20972215 CGCCACCATCTTGGGAGCTCTGG + Intergenic
1189744916 X:44159088-44159110 GGCCAACCCATAGGGAGCTCTGG - Intronic
1189954213 X:46261640-46261662 CGCCACCATCTTGGGAGCTCTGG - Intergenic
1191167434 X:57405221-57405243 CGCCACCATCTTGGGAGCTCTGG - Intronic
1193295429 X:79827207-79827229 CGCCACCATCTTGGGAGCTCTGG - Intergenic
1196772470 X:119308838-119308860 TGCCACCATCTTGGGAGCTCTGG - Intergenic
1197545267 X:127816244-127816266 TGCCACCATCTTGGGAGCTCTGG - Intergenic
1199268727 X:145858161-145858183 CGCCACCATCTTGGGAGCTCTGG - Intergenic
1200401629 X:156023350-156023372 GGCCAGCACCTCAGGAGCTGGGG - Intergenic
1200762739 Y:7054945-7054967 TGCCACCATCTTGGGAGCTCTGG + Intronic
1202062426 Y:20901162-20901184 CGCCACCATCTTGGGAGCTCTGG + Intergenic