ID: 1155300767

View in Genome Browser
Species Human (GRCh38)
Location 18:24426861-24426883
Sequence CAGCCGAGGGGCCCTCCGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 271}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155300758_1155300767 6 Left 1155300758 18:24426832-24426854 CCGGCTCGCCTCGCCATGCCAGT 0: 1
1: 0
2: 0
3: 2
4: 94
Right 1155300767 18:24426861-24426883 CAGCCGAGGGGCCCTCCGCCTGG 0: 1
1: 0
2: 2
3: 19
4: 271
1155300757_1155300767 18 Left 1155300757 18:24426820-24426842 CCAGGCTCGGCTCCGGCTCGCCT 0: 1
1: 0
2: 0
3: 23
4: 167
Right 1155300767 18:24426861-24426883 CAGCCGAGGGGCCCTCCGCCTGG 0: 1
1: 0
2: 2
3: 19
4: 271
1155300760_1155300767 -7 Left 1155300760 18:24426845-24426867 CCATGCCAGTCCTCCTCAGCCGA 0: 1
1: 0
2: 0
3: 13
4: 190
Right 1155300767 18:24426861-24426883 CAGCCGAGGGGCCCTCCGCCTGG 0: 1
1: 0
2: 2
3: 19
4: 271
1155300759_1155300767 -2 Left 1155300759 18:24426840-24426862 CCTCGCCATGCCAGTCCTCCTCA 0: 1
1: 0
2: 0
3: 16
4: 243
Right 1155300767 18:24426861-24426883 CAGCCGAGGGGCCCTCCGCCTGG 0: 1
1: 0
2: 2
3: 19
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155300767 Original CRISPR CAGCCGAGGGGCCCTCCGCC TGG Intronic
900337225 1:2170243-2170265 CAGCCGAGGGGCCTCCAGCATGG + Intronic
900605811 1:3523073-3523095 CAGCCCTGGGGCCCCCCCCCCGG - Intronic
901202057 1:7472644-7472666 CAGCTGCTGGGCCCTCAGCCTGG + Intronic
901426023 1:9182762-9182784 CAGGCGAGAGGCCCTCGGACTGG - Intergenic
901435920 1:9247431-9247453 CAGCCGTGGCGCCCCCTGCCTGG + Intronic
905959993 1:42035623-42035645 CAGCTGAGGGGGCCGGCGCCCGG + Intronic
906191386 1:43901628-43901650 AAGCTGAGGAGCTCTCCGCCTGG + Intronic
906655102 1:47542533-47542555 CAGCAGAGGGACCCTGGGCCAGG - Intergenic
907450284 1:54542052-54542074 CGGCTCAGGGGCGCTCCGCCCGG + Intergenic
908523432 1:64966263-64966285 CAGGCGAGGGGCGCGCAGCCCGG - Intronic
908881961 1:68742861-68742883 CAGCAGAGGGGCCCTGGGCCTGG - Intergenic
909054186 1:70803672-70803694 CAGCAGAGGGGACCTGGGCCAGG - Intergenic
909250202 1:73344119-73344141 CAGCAGGGGGGCCCTGGGCCTGG - Intergenic
910642748 1:89481097-89481119 CAGCAGAGGGACCCTGGGCCTGG + Intergenic
912004316 1:104878353-104878375 CAGCAGAGGGACCCTGAGCCTGG - Intergenic
912471637 1:109910922-109910944 CAGCGGTGCGGCCCTCGGCCGGG + Exonic
917817511 1:178725535-178725557 CAGCCCCGGGGCCCGCGGCCGGG - Intronic
917894950 1:179478542-179478564 CAGCAGAGGGACCCTGGGCCTGG + Intronic
919156833 1:193776202-193776224 CAGCAGAGGGACCCTAGGCCTGG + Intergenic
919724531 1:200873231-200873253 CCGCCGCGGGCCCCGCCGCCCGG - Exonic
919763070 1:201110530-201110552 AAGCTGAGGAGCCCTCAGCCAGG - Intronic
920249125 1:204610891-204610913 CAGCCAAAGAACCCTCCGCCTGG - Intergenic
920665967 1:207963340-207963362 CAGCCGAAAGCCCCTCCGCTGGG - Intergenic
922115402 1:222608196-222608218 CAGCAGAGGGACCCTGGGCCAGG + Intergenic
922757318 1:228103521-228103543 CAGGCGAGAGCCACTCCGCCCGG - Intronic
1062929705 10:1344821-1344843 CAGGAGAGGAGCCCTCAGCCTGG + Intronic
1063565893 10:7172042-7172064 CGGCGGAGGTGCCCTCGGCCCGG - Exonic
1067848027 10:49738363-49738385 CAGCAGAGGTGCCCTCACCCTGG + Intronic
1067972766 10:50991555-50991577 CGGCCGAGATGCCCTGCGCCCGG - Intronic
1069787562 10:70998446-70998468 CAGACGGGGGTCCCTCCTCCAGG + Intergenic
1070712000 10:78689615-78689637 CAGCCTGGGGCCCCTCTGCCTGG - Intergenic
1071159269 10:82727350-82727372 TAGCAGAGGGGCCCTAGGCCTGG - Intronic
1072633865 10:97164941-97164963 CAGGCCAGGGGCCCTGCTCCAGG + Intronic
1072704088 10:97667485-97667507 CAGGCGTGAGGCCCTGCGCCCGG + Intronic
1074640211 10:115370922-115370944 CAGCAGAGGGACCCTGGGCCTGG - Intronic
1075550317 10:123388102-123388124 CAGCAGAGGGACCCTGGGCCAGG - Intergenic
1076795264 10:132795146-132795168 CAGCCGAGGGGCGCTCCCCTCGG + Intergenic
1076824127 10:132958815-132958837 GAGCCGTGGGGCCCTCCCCCTGG + Intergenic
1077252172 11:1565527-1565549 CAGCTAAGGGGCCCTCAGCTCGG - Intronic
1077362165 11:2145571-2145593 CTGCCGAGGTGCCTTCCCCCAGG + Intronic
1077514408 11:2992799-2992821 TCGCGGAGGGCCCCTCCGCCTGG + Intergenic
1078308964 11:10219383-10219405 CAGCAGGGGGGCCCTGGGCCTGG + Intronic
1078687392 11:13546307-13546329 CAGCAGAGGGGCCCTGGGCCTGG - Intergenic
1079134108 11:17766529-17766551 CAGCAGAGGGACCCTCTGCCTGG - Intronic
1080973354 11:37304302-37304324 CAGCAGAGGGACCCTGGGCCTGG + Intergenic
1083580058 11:63818980-63819002 CTGGAGAGGGGCTCTCCGCCCGG - Exonic
1084532194 11:69734121-69734143 CAGCCAAGGGGTCCCCCGACAGG - Intergenic
1085651497 11:78272835-78272857 CAGCAGAGGGACCCTGGGCCCGG - Intronic
1086287941 11:85271109-85271131 CAGCAGAGGGACCCTGGGCCTGG - Intronic
1086765808 11:90693799-90693821 CAGCAGAAGGGCCCTTGGCCTGG - Intergenic
1088462131 11:110093154-110093176 CAGCCCCGGGGCCCTCCGGCAGG - Intergenic
1088462244 11:110093529-110093551 CGGCCCCGGCGCCCTCCGCCTGG - Intronic
1089609458 11:119661367-119661389 CAGCAGAGGGGCCTGCCTCCTGG + Exonic
1089827672 11:121293159-121293181 GAGCGGAAGGCCCCTCCGCCCGG - Intronic
1091626729 12:2126867-2126889 GAGGGGAGGGGCCCTCAGCCTGG - Intronic
1092662702 12:10755719-10755741 CAGCAGAGGGACCCTGGGCCCGG + Intergenic
1093238340 12:16639551-16639573 CAGCCGTGAGCCCCTGCGCCTGG - Intergenic
1094762550 12:33551225-33551247 CAGCTGAGGGACCCTGTGCCTGG - Intergenic
1095382778 12:41615416-41615438 CAGCAGAGGGACCCTGGGCCCGG - Intergenic
1096818178 12:54214938-54214960 CAGCCTGGGCGCCCTCTGCCGGG + Intergenic
1097218244 12:57430767-57430789 CAGCCGAGCGGCCGTGGGCCCGG - Exonic
1098319801 12:69231985-69232007 GAGCCGTGGGGCCCTGGGCCTGG - Intergenic
1098630888 12:72720562-72720584 CAGCAGAGGGACCCTGGGCCTGG - Intergenic
1102915617 12:116749982-116750004 CAGCCGAGGAGCCCAGCACCAGG - Exonic
1104172133 12:126292160-126292182 CAGCAGGGGGGCCCTGGGCCTGG + Intergenic
1104447489 12:128845642-128845664 CAGCAGAGGGGCCCTTCCTCCGG - Intergenic
1104447566 12:128845969-128845991 CAGCAGAGGGGCCCTTCCTCCGG - Intergenic
1104965202 12:132505804-132505826 CAGCAGAGGGGCCAGCCGCACGG + Intronic
1105609469 13:21955323-21955345 CAGCAGAGGGACCCTGGGCCCGG + Intergenic
1106527097 13:30550602-30550624 CATCCGAGGGTCCCTCGGCATGG - Intronic
1106631567 13:31479587-31479609 CAGCAGAGGGACCCTAGGCCTGG + Intergenic
1106917317 13:34529558-34529580 CAGCAGAGGGACCCTGGGCCTGG - Intergenic
1110395887 13:75029207-75029229 CAGCAGAGGGACCCTGGGCCTGG - Intergenic
1110705911 13:78602121-78602143 CCGCCCAGGAGCCCGCCGCCCGG + Exonic
1112503456 13:99959042-99959064 CGGCCGAGGGGCCGGCCGGCTGG + Intergenic
1113805872 13:113109837-113109859 CAGCCGAGGGGACCGTCACCCGG - Intronic
1117365901 14:55027163-55027185 CAGCTGCGGCGCCCTCCGCGTGG + Intergenic
1120967951 14:90184274-90184296 GAGACGAGGGGCCCTGCCCCAGG + Exonic
1121063475 14:90938776-90938798 CAGCAGAGAGGCCCTGTGCCCGG + Intronic
1122602982 14:102930431-102930453 AAGCCGAGGGGCGCTCCAGCCGG - Exonic
1122626563 14:103088098-103088120 CAGCCGAGGGCCCTTCTCCCAGG - Intergenic
1122640364 14:103155952-103155974 CAGCAGAGGGGCTCCCCCCCCGG + Intergenic
1122863485 14:104593192-104593214 CAGCCAAGGGGCCCTGTGCGAGG + Exonic
1123675006 15:22702188-22702210 CAGGCGTGAGGCCCTGCGCCCGG - Intergenic
1123739261 15:23219445-23219467 AATCCCAGGGACCCTCCGCCAGG - Intergenic
1124290480 15:28448401-28448423 AATCCCAGGGACCCTCCGCCAGG - Intergenic
1124292757 15:28469147-28469169 AATCCCAGGGACCCTCCGCCAGG + Intergenic
1124327019 15:28775177-28775199 CAGGCGTGAGGCCCTGCGCCCGG - Intergenic
1124566816 15:30823639-30823661 CCGCAGAGGGGCACTCCACCGGG - Intergenic
1127752532 15:62060208-62060230 CAGCCGAGGGCTGCTCCGTCCGG - Intronic
1128280088 15:66387228-66387250 CAGCCCCGGGGCCCGCGGCCCGG + Exonic
1129672061 15:77612953-77612975 CTGCCGAGGGGCCCTCCATGGGG - Intergenic
1130539359 15:84811145-84811167 CAGGCTAGGGCCCCTCCACCAGG + Intergenic
1130656383 15:85794612-85794634 CAGCCGCGGGGCCCCCTCCCGGG + Intronic
1131484643 15:92809552-92809574 AAGCGGACGCGCCCTCCGCCTGG + Intronic
1132286646 15:100668427-100668449 CAGAGGAGGGGGCTTCCGCCTGG + Intergenic
1132668560 16:1093478-1093500 CAGCCGCGGGGCCCCTCACCCGG + Exonic
1132675564 16:1119918-1119940 CAGGCCTGGGGCCCTCCTCCAGG + Intergenic
1132678221 16:1129434-1129456 CAGCCTGGCCGCCCTCCGCCCGG + Intergenic
1132840154 16:1974925-1974947 CAGCCTAGTGGCCTTCCACCCGG + Exonic
1133270313 16:4608157-4608179 CAGCCGGCAGGGCCTCCGCCAGG + Intergenic
1134660625 16:15981607-15981629 CAGCAGGGGGGCCCTGGGCCCGG + Intronic
1135135330 16:19882936-19882958 TAGAAGAGGGGCCCTCCGCTGGG - Intronic
1136375044 16:29860441-29860463 CAGCTTACGGGCCCTCCTCCTGG + Intronic
1136759646 16:32720192-32720214 AATCCCAGGGACCCTCCGCCAGG - Intergenic
1136808458 16:33150194-33150216 AATCCCAGGGACCCTCCGCCAGG + Intergenic
1137673887 16:50294349-50294371 CAGCCGAAGGGCACTCCTGCAGG - Intronic
1138895408 16:61198574-61198596 CAGCAGAGGGACCCTGGGCCTGG - Intergenic
1139961749 16:70721946-70721968 GAGCTGAGGTGCCCTCCACCGGG - Intronic
1140410441 16:74737759-74737781 CAGCCGAGGGTCCCCAGGCCTGG - Intronic
1142009949 16:87708897-87708919 CAGCAGAGGGGCCCTGGGTCAGG + Intronic
1142010549 16:87711783-87711805 CTGCACAGGGACCCTCCGCCCGG + Intronic
1142144860 16:88488678-88488700 CAGCTGGGGGCCCCTCCACCAGG - Intronic
1147161034 17:38569508-38569530 GAGTCGAGGGGCACTCCGGCTGG + Intronic
1149204466 17:54227890-54227912 CAGCAGAGGGACCCTGGGCCTGG - Intergenic
1151882276 17:76902931-76902953 CCGCCGAGGGACCCTTCCCCAGG - Intronic
1151923177 17:77173296-77173318 CAGCCTCAGGGCCCTCCCCCAGG - Intronic
1152465845 17:80465810-80465832 CAGGCCAGGGGCCTCCCGCCTGG + Intergenic
1152645439 17:81466542-81466564 CAGGAAAGGGGCCCTCCTCCTGG - Intergenic
1153226801 18:2906325-2906347 CAGCCCTGGGGCCCCCCGGCAGG + Intronic
1154161264 18:11981969-11981991 AAGCAGAGGGGCTCGCCGCCAGG - Intronic
1155007515 18:21741555-21741577 CAGCGGCGGAGCCCACCGCCCGG + Exonic
1155300767 18:24426861-24426883 CAGCCGAGGGGCCCTCCGCCTGG + Intronic
1160207585 18:76847751-76847773 CAGGCGTGAGCCCCTCCGCCCGG + Intronic
1160377368 18:78423173-78423195 TAGCAGGGGGGCCCTCCCCCAGG - Intergenic
1160424351 18:78769933-78769955 CAGCAAAGTGGCCCACCGCCGGG - Intergenic
1160599371 18:80001062-80001084 CAGCAGGGGGGCCCTGGGCCAGG - Intronic
1161051111 19:2164417-2164439 CAGCCGCGGGGCCCTCGGCCGGG - Intronic
1161380682 19:3963613-3963635 CAGCCGAGGGGGCCCCCGCCAGG + Intronic
1161595971 19:5151147-5151169 CAGCAGAGGGGCCCTGCACTCGG - Intronic
1162460593 19:10811835-10811857 GAGCCCAGGGGCCCTCCCCAAGG - Intronic
1162470617 19:10870651-10870673 CGGGAGAGGGGCCCTGCGCCGGG + Intergenic
1163230063 19:15995669-15995691 CAGCAAAGGGGCCCTGGGCCTGG - Intergenic
1163241726 19:16067736-16067758 CAGGTGAGGTGCCCTCCGCTGGG + Exonic
1165091110 19:33388851-33388873 CAGCTGAGGGGGCCTCAGCTTGG + Intronic
1165204448 19:34172151-34172173 CCGACGCGGGGCCCTCGGCCTGG - Intergenic
1165766541 19:38354943-38354965 CAGCCTAGGGGCCCTCCTCAGGG - Intronic
1166790748 19:45396995-45397017 CAGCCGAGGGTCCCCCCGGAAGG - Exonic
1166834309 19:45657952-45657974 CAGCAGAGGGGCTCTCAGCTGGG - Intergenic
1166920564 19:46226572-46226594 CAGCAGAGGGGCCTCCGGCCTGG + Intergenic
1167752463 19:51389118-51389140 CAGCCCCAGGGCCCCCCGCCCGG + Exonic
925275201 2:2643699-2643721 CAGCCCAGGGGCCCACGGGCTGG - Intergenic
926087956 2:10032041-10032063 CACCCGAGGGGGCCTCACCCAGG + Intergenic
927215840 2:20667401-20667423 CAGCCGCGGCGCCCGCAGCCTGG - Exonic
927714156 2:25341741-25341763 CAGCCGCGGCGCCCCCCGCCCGG + Intronic
929868422 2:45737534-45737556 GAGCCGAGAGGTCCTCCGCTGGG - Intronic
930027197 2:47036234-47036256 CAGCCCTGGGGCCCTTCACCAGG + Intronic
930162462 2:48171990-48172012 CAGACGAGAGCCCCTGCGCCGGG - Intergenic
933268172 2:80204079-80204101 CAGCAGAGGGACCCTGGGCCCGG + Intronic
937046115 2:118852892-118852914 GAGCCAAGGGGCCCTGCGTCGGG - Intergenic
943060669 2:183038545-183038567 CGGCCGACGGGCCCTCGGCATGG + Exonic
945618659 2:212106733-212106755 CAGCAGAGGGACCCTGGGCCAGG - Intronic
946397262 2:219449210-219449232 CCGCCGAGGGGCCCGCAGCCAGG + Exonic
946402146 2:219473728-219473750 CTGCCGAGGGGCCCTCCTAGAGG + Exonic
946575593 2:221071949-221071971 CAGCAGAGGGGCCCTGGACCTGG + Intergenic
948209256 2:236179839-236179861 CTGCCCAGAGGCCCTCAGCCAGG - Intergenic
948414703 2:237794560-237794582 CAGTTGAGGGGGCCTCTGCCAGG + Intronic
1168805572 20:670476-670498 CAGCCTGGAGGCCCTCTGCCGGG - Intronic
1170629866 20:18057294-18057316 CAGCCAACGGTCCCGCCGCCGGG + Intronic
1172083275 20:32358843-32358865 CAGCCGAGGGGGGCTCCGTGGGG + Intronic
1172389967 20:34559549-34559571 CAGAACAGGGGCCCACCGCCCGG - Intronic
1172481697 20:35275378-35275400 CAGCATAGCGGCCCTCCCCCAGG + Exonic
1172835290 20:37869494-37869516 CTGCTGGGGGGCCCTCGGCCAGG + Intronic
1173660980 20:44733576-44733598 CAGCCGAGAGGCCACCTGCCAGG + Intergenic
1177394127 21:20511090-20511112 CAGCAGGGGGGCCCTGAGCCAGG + Intergenic
1180174657 21:46081775-46081797 CAGCCCAGGGGCCCTGCAGCAGG + Intergenic
1181378117 22:22476685-22476707 CAGCCGCGGGCCCCCACGCCCGG - Intergenic
1183281269 22:36933878-36933900 CAGCCCTGGAGCCCTCCACCAGG + Exonic
1184252586 22:43269192-43269214 CTCCCGATGGGCCCTCCCCCAGG + Intronic
1185277344 22:49955511-49955533 CATCCCAGGAGCCCTCCTCCCGG + Intergenic
1185296236 22:50056693-50056715 CACCCCTGGGGTCCTCCGCCTGG + Intronic
949552438 3:5122383-5122405 CACACGAGCGGGCCTCCGCCCGG - Exonic
949693009 3:6662314-6662336 CAGCCCAGGGACCCTGGGCCTGG + Intergenic
950449138 3:13055828-13055850 CACCCCAGGGCCCCTCCGCCAGG - Intronic
951080453 3:18445218-18445240 CCGCCGAGGCTCCCACCGCCAGG - Intronic
953535012 3:43770609-43770631 CAACCCTGGGGCCCTCAGCCTGG + Intergenic
953914632 3:46910330-46910352 GAACCGAGAGGCCCTGCGCCTGG + Intergenic
953947918 3:47164560-47164582 GCGCCGAGGGCCCCTCCCCCAGG + Intergenic
954826449 3:53377657-53377679 CAGGCGAGGGCCCCTGCGCCTGG + Intergenic
956487736 3:69739945-69739967 CGGCCGAGGGTCCCCGCGCCTGG - Intronic
958157344 3:89771602-89771624 CAGCAGAGGGACCCTGGGCCTGG + Intergenic
958685448 3:97387041-97387063 GAGCAGAGGGGCCCTCGACCTGG + Intronic
959846561 3:111040375-111040397 CAGCAGGGGGGCCCTGGGCCTGG - Intergenic
960261779 3:115576529-115576551 CAGCAGAGGAGCCCTGAGCCGGG - Intergenic
961202371 3:125055479-125055501 CAGCCGTAGGCCCCTCCGCGCGG - Intronic
961839573 3:129697404-129697426 CAGCAGGGGGGTCCTCGGCCTGG + Intronic
965662096 3:171052735-171052757 CAGCAGAGGGACCCTTGGCCTGG - Intergenic
965795349 3:172433264-172433286 CAGCAGAGGGACCCTGGGCCTGG + Intergenic
966059266 3:175734761-175734783 CAGCAGAGGGACCCTGGGCCTGG + Intronic
968523201 4:1043797-1043819 CAGCCGCGGGACCCTCTGCAGGG + Intergenic
968531028 4:1091747-1091769 CTGCACAGGGGCCCTCCTCCAGG + Intronic
968619224 4:1596238-1596260 CAGCCCAGCGTCCCTCAGCCTGG - Intergenic
968636892 4:1685258-1685280 CACCCCAGGGGCCCCTCGCCAGG - Intergenic
968650364 4:1757935-1757957 CAGCCGAGTGCCCTTCCCCCAGG + Intergenic
968704632 4:2072217-2072239 GAGGCCTGGGGCCCTCCGCCAGG - Exonic
968775369 4:2536788-2536810 CAGCCGGGGGGCGCTGCGCGGGG - Intronic
971372332 4:26029014-26029036 CGTCCCAGGGGACCTCCGCCAGG + Intergenic
973107741 4:46361264-46361286 CAGCAGGGGGACCCTCGGCCAGG - Intronic
974206078 4:58705088-58705110 CAGCAGAGGGACCCTGGGCCCGG - Intergenic
976204218 4:82609316-82609338 CAGTCCAGGGGCCCTCCGAGAGG + Intergenic
976581371 4:86740501-86740523 CAGCAGAGGGACCCTGGGCCCGG + Intronic
977435419 4:96989168-96989190 CAGCAGGGGGGCCCTGGGCCTGG - Intergenic
978201553 4:106028811-106028833 CAGCAGAGGGACCCTAGGCCTGG - Intergenic
978777370 4:112516776-112516798 CCGCCGAGGCTCCCCCCGCCCGG + Intergenic
979426443 4:120572747-120572769 CAGCAGAGGGACCCTGGGCCTGG + Intergenic
979700050 4:123656908-123656930 CAGCAGGGGGGCCCTGGGCCTGG + Intergenic
980335526 4:131468793-131468815 CAGCACAGGGGCCCTGGGCCTGG - Intergenic
985073402 4:186190852-186190874 CAGCACTGGGGCCCTCTGCCGGG + Intergenic
985783815 5:1883940-1883962 CAGGGGAGGGCGCCTCCGCCAGG - Intronic
985809152 5:2070476-2070498 CAGCACAGGGGCCCTGGGCCCGG - Intergenic
986026102 5:3852855-3852877 CAGCAGAGGGGCCTTTCCCCAGG - Intergenic
986640639 5:9868513-9868535 CAGCAGGGGGGCCCTGGGCCTGG + Intergenic
987511706 5:18847892-18847914 CAGCAGAGGGACCCTGCGCCAGG + Intergenic
987802891 5:22721149-22721171 CAGCAGTGGGGCCCTGGGCCGGG - Intronic
989258788 5:39396089-39396111 CAGGTGAGGGGCACTACGCCCGG + Intronic
991009993 5:61872358-61872380 CAGCAGAGGGACCCTAGGCCCGG + Intergenic
992530115 5:77645253-77645275 CGGCCGAGGGGCCCCCGGGCGGG - Intergenic
994072880 5:95621061-95621083 CAGCCGCGGGGGCCTGCGGCCGG - Exonic
994878108 5:105451069-105451091 CAGCAGAGGGACCCTGGGCCCGG - Intergenic
995630548 5:114127516-114127538 CAGCAGGGGAGCCCTCGGCCTGG + Intergenic
996214358 5:120848981-120849003 CAGCAGAGGGACCCTGGGCCTGG + Intergenic
997274655 5:132574421-132574443 CAGCAGAGGGACCCTGGGCCTGG + Intronic
998018994 5:138753890-138753912 CGGCCGAGGGGCCCGGCGCGGGG - Intronic
998457907 5:142287858-142287880 CAGCCGAGGGGCCAGCCTGCTGG - Intergenic
999012273 5:148056033-148056055 CAGCAGAGGGACCCTAAGCCTGG - Intronic
999262587 5:150246907-150246929 CACCCGAGGGGCCCTCTGACTGG - Intronic
1000052662 5:157575843-157575865 CAGCCCCGCGGGCCTCCGCCAGG + Intergenic
1002896299 6:1382328-1382350 CAGCCCCGGGCCCCTCCGCGGGG - Intergenic
1002896958 6:1384901-1384923 CAACCGAGGGGACCCGCGCCCGG + Intergenic
1005984168 6:30860134-30860156 CAGCAGGGGGGCCCTAGGCCTGG + Intergenic
1006931501 6:37691820-37691842 CAGAAGAGGGGCCATGCGCCAGG + Intronic
1007557932 6:42782512-42782534 CCGCCGAGGCGCCCCCGGCCCGG - Intronic
1009620005 6:66063584-66063606 CAGCAGGGGGGCCCTGGGCCTGG - Intergenic
1012683194 6:102209432-102209454 CAGCACAGGGGCCCTGGGCCTGG - Intergenic
1012771164 6:103436778-103436800 CAGCAGTGGGGCCCTGGGCCTGG + Intergenic
1013149018 6:107426154-107426176 CAGCGGAGGGACCCTGGGCCTGG - Intronic
1014116021 6:117669816-117669838 CAGCAGAGGGGCCCTGGACCTGG - Intergenic
1016253183 6:142071765-142071787 CAGCAGAGGGACCCTGGGCCTGG - Intronic
1016947245 6:149546324-149546346 GAGCAGAGCGGCCCTCCGCGCGG + Intergenic
1019010622 6:168841351-168841373 CTGCCGAGGGGGCCTCAGCGGGG + Intergenic
1019458863 7:1146531-1146553 GAGGTGAGGGGCCCTCTGCCCGG - Intergenic
1019542840 7:1559323-1559345 CAGCTCATGGGCCCTCAGCCGGG - Intronic
1024554190 7:50589205-50589227 CAGCACAGGGGCCCTCCTGCTGG + Intergenic
1024609656 7:51053721-51053743 CGGCCGAGGGGCCCTGTGCCAGG - Intronic
1024673545 7:51617896-51617918 CAGCTGAGGGGCCCTCTCCCTGG - Intergenic
1026098299 7:67364605-67364627 CTGCCGAGGAGCCCACCGCGGGG + Intergenic
1032015747 7:128379375-128379397 CAGCAGAGGGGCCCTCCAGTGGG + Intergenic
1033421132 7:141205510-141205532 TAGCTGAGGGGCCCTCCCTCTGG + Intronic
1037898914 8:22676167-22676189 CAGCAGAGGGGCCCTCCCCTGGG + Intergenic
1039620853 8:38996268-38996290 CACCCCCGGGGCCCTCCGGCTGG + Exonic
1040076986 8:43246719-43246741 CGGCCTAGGGGCCCTCAGGCTGG + Intergenic
1042102154 8:65285084-65285106 CAGAGGAGGGGGCCCCCGCCTGG - Intergenic
1045214203 8:100130365-100130387 CAGCCCAGGGACCCTGGGCCAGG + Intronic
1045583014 8:103500085-103500107 CAGCCGAAGGGCCCTGGCCCCGG + Intergenic
1046806699 8:118486875-118486897 GAGCAGAGGTGCCCTCCGACAGG + Intronic
1047253757 8:123200433-123200455 CAGCTGGGGGGCCCTCGCCCTGG + Intronic
1047931103 8:129728808-129728830 CAGCTCAGGGTCCGTCCGCCTGG - Intergenic
1050079766 9:1904157-1904179 CAGCAGAGGGACCCTTGGCCAGG - Intergenic
1050155973 9:2666796-2666818 CAGCAGAGGGACCCTGGGCCTGG - Intergenic
1052701304 9:31941257-31941279 CAGCAGAGGGACCCTGGGCCTGG - Intergenic
1053752817 9:41273642-41273664 CAGCCTGGGGGCCCTCAGGCTGG - Intergenic
1054258341 9:62837994-62838016 CAGCCTGGGGGCCCTCAGGCTGG - Intergenic
1054333428 9:63782047-63782069 CAGCCTGGGGGCCCTCAGGCTGG + Intergenic
1054351536 9:64021093-64021115 CGGCCTGGGGGCCCTCAGCCTGG + Intergenic
1055167863 9:73219098-73219120 CAGCAGAGGGACCCTGGGCCTGG - Intergenic
1057273796 9:93665599-93665621 CTCCCGAGGGGTCCTCTGCCAGG - Intronic
1057285381 9:93749283-93749305 CAGCAGGGGGGCCCTAGGCCTGG + Intergenic
1059871825 9:118586676-118586698 CAGCAGAGGGGTCCTGCACCTGG - Intergenic
1060389917 9:123268645-123268667 CAGCCGCGGGGCCCGCCCCCTGG - Intergenic
1061580042 9:131530965-131530987 CGGCCGAGGGGCCCCCTGCCAGG - Intronic
1061868806 9:133509230-133509252 CAGCCCTGGGGCCCCCTGCCAGG - Intergenic
1062569553 9:137178841-137178863 CTGCCCTGGGGGCCTCCGCCTGG + Intronic
1202800433 9_KI270719v1_random:170381-170403 CAGCCTGGGGGCCCTCAGGCTGG + Intergenic
1185628684 X:1500723-1500745 CAGGCGAGAGGCCCTGCGCCCGG + Intronic
1185658085 X:1702192-1702214 CAGCGGAGGTGGCCTCTGCCAGG + Intergenic
1185658092 X:1702235-1702257 CAGCGGAGGTGGCCTCTGCCAGG + Intergenic
1185658126 X:1702449-1702471 CAGCGGAGGTGGCCTCTGCCAGG + Intergenic
1185658133 X:1702492-1702514 CAGCGGAGGTGGCCTCTGCCAGG + Intergenic
1185658183 X:1702792-1702814 CAGCGGAGGTGGCCTCTGCCAGG + Intergenic
1185658190 X:1702834-1702856 CAGCGGAGGTGGCCTCTGCCTGG + Intergenic
1186350219 X:8732273-8732295 CGGCCCATGGGCCCTGCGCCCGG - Intergenic
1186611130 X:11139280-11139302 AAGCCGAGCGGCCCACGGCCAGG - Exonic
1186620473 X:11235362-11235384 GAGCCGGGGGGCCCTGGGCCAGG + Intronic
1188997573 X:36904750-36904772 CAGCAGAGGGACCCTGGGCCCGG - Intergenic
1191673334 X:63769626-63769648 CAGCAGAGGGACCCTGGGCCCGG - Intronic
1193519625 X:82512554-82512576 CAACCCAGGGGCCCTGGGCCTGG + Intergenic
1197128226 X:122972803-122972825 CAGCAGGGGGGCCCTGGGCCTGG - Intergenic
1199020284 X:142870430-142870452 CAGCAGAGGGACCCTGGGCCAGG - Intergenic
1199421038 X:147644800-147644822 GAGCAGAGGGGCCCTGGGCCTGG - Intergenic
1199480896 X:148297523-148297545 CAGCAGTGGGGCCCTGGGCCTGG - Intergenic
1199909619 X:152271750-152271772 CAGCAGAGGGGCCCTGGACCTGG - Intronic
1200080879 X:153575771-153575793 CACCCGAGGGCCCCTCCTCTGGG - Intronic
1200784244 Y:7245508-7245530 CAGCCGTGAGGCCCCGCGCCAGG - Intergenic