ID: 1155304863

View in Genome Browser
Species Human (GRCh38)
Location 18:24469177-24469199
Sequence CAGTTGGGACAACTTGCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 174}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155304863_1155304868 2 Left 1155304863 18:24469177-24469199 CCCAAGGCAAGTTGTCCCAACTG 0: 1
1: 0
2: 1
3: 13
4: 174
Right 1155304868 18:24469202-24469224 ATACTAAGTCTATAGTAGATTGG 0: 1
1: 0
2: 1
3: 11
4: 88
1155304863_1155304869 25 Left 1155304863 18:24469177-24469199 CCCAAGGCAAGTTGTCCCAACTG 0: 1
1: 0
2: 1
3: 13
4: 174
Right 1155304869 18:24469225-24469247 ATAGACATGACATTCATGACAGG 0: 1
1: 0
2: 0
3: 10
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155304863 Original CRISPR CAGTTGGGACAACTTGCCTT GGG (reversed) Intronic
903556753 1:24199470-24199492 CAGTCTGGACCACTTTCCTTTGG - Intergenic
906590198 1:47017765-47017787 AAGGTGGGACAACTTGCCAGAGG - Intergenic
907614843 1:55913188-55913210 CAGTCAGGACACCCTGCCTTTGG + Intergenic
907929176 1:58982963-58982985 CTGTTGGGATAACCTGTCTTGGG + Intergenic
910259910 1:85284568-85284590 CTGTTGGGACAACCTGCCTGTGG + Intergenic
910259920 1:85284636-85284658 CTATTGGGACAACCTGCCTGTGG + Intergenic
911759902 1:101602238-101602260 GATTTGGGACAAGTTGCTTTGGG + Intergenic
912681340 1:111730975-111730997 CAGTTTGGACTCCTTGCCTCTGG - Intronic
915619812 1:157074298-157074320 CAGCTCGGACAACTTGGCGTTGG - Intergenic
916295540 1:163215330-163215352 GAGTTTGGATAACTTGCCTAAGG - Intronic
917987083 1:180331762-180331784 GGGTTGGGACAATTTTCCTTGGG - Intronic
918151484 1:181800862-181800884 CTGTTGGGACAACTTTGGTTTGG - Intronic
918884623 1:190176217-190176239 CAGTTGGGTCATCTTTCCTAGGG - Intronic
920166418 1:204039407-204039429 CAGTGGGCACCACTTGCCGTTGG + Intergenic
922413543 1:225398394-225398416 AACTTGGGGCAACATGCCTTAGG + Intronic
922533669 1:226363949-226363971 CTGTTGGGAGAAGTTGCCCTTGG - Exonic
922934711 1:229413945-229413967 GATTTGGGACAAGTTGCATTGGG - Intergenic
924180545 1:241435520-241435542 GATTTGGGACAAGTTGCATTGGG - Intergenic
1063062447 10:2570340-2570362 CAGTTTGCATAACTTGTCTTAGG - Intergenic
1063598655 10:7460675-7460697 CAAGTGGGAAAACTTGGCTTCGG + Intergenic
1065233482 10:23622489-23622511 CAGTTGGGACAAATGTCCATGGG - Intergenic
1067550690 10:47233534-47233556 CAGTTTGTGCAGCTTGCCTTTGG + Intergenic
1070585581 10:77763533-77763555 CACTTCGGAAAACTTGCCCTAGG + Intergenic
1071187122 10:83058664-83058686 GATTTGGGACAAGTTGCATTGGG - Intergenic
1071226863 10:83540425-83540447 CAGTTGAGAAAGCTGGCCTTGGG - Intergenic
1071600182 10:86955180-86955202 TAGATGGGACACCTTGCCTGGGG + Intronic
1071819324 10:89264355-89264377 TTGTTGGGACAACCTGCCTGTGG - Intronic
1073847577 10:107576244-107576266 CACTTGTAACAAGTTGCCTTTGG + Intergenic
1074981680 10:118624955-118624977 CAGTTGGGACACGTGGACTTTGG + Intergenic
1077612070 11:3649448-3649470 GATTTGGGACAAGTTGCATTGGG - Intronic
1077766499 11:5164483-5164505 GATTTGGGACAAGTTGCATTGGG + Intronic
1077846857 11:6034410-6034432 CAGTTGGGAAAACATGGCTTGGG + Intergenic
1077883238 11:6367327-6367349 GATTTGGGACAAGTTGCATTGGG - Intergenic
1080549105 11:33353735-33353757 CATTTGGTATAACTTGTCTTTGG + Exonic
1081679587 11:44992346-44992368 CAGTAGGCACCGCTTGCCTTTGG - Intergenic
1084160526 11:67346804-67346826 AAGTTGGCAAAACTTGCATTTGG - Intronic
1085201838 11:74706634-74706656 CAGATGGGACAGCAGGCCTTGGG - Intronic
1086092811 11:83021018-83021040 TTGTTGGGACAACCTGCCTGCGG + Intronic
1086133041 11:83420640-83420662 GATTTGGGACAAGTTGCATTGGG - Intergenic
1086134946 11:83435760-83435782 GATTTGGGACAAGTTGCATTGGG + Intergenic
1089327819 11:117669356-117669378 CAGTGGTGGCACCTTGCCTTGGG + Intronic
1090546600 11:127773252-127773274 GATTTGGGACAAGTTGCATTGGG + Intergenic
1091560227 12:1606543-1606565 AAGTTGGAACAGCTTGCCTGGGG + Intronic
1093441432 12:19201992-19202014 GAGTTAGTACCACTTGCCTTGGG + Intronic
1094224928 12:28034229-28034251 CAGTTGGGAGAACTTGTATAAGG - Intergenic
1096626435 12:52898813-52898835 CAGCTCGGACAACTTGGCGTTGG + Exonic
1097542306 12:60956161-60956183 GATTTGGGACAAGTTGCATTGGG + Intergenic
1102840537 12:116115933-116115955 CACTTTGGAAAAGTTGCCTTTGG + Intronic
1104548604 12:129734588-129734610 CAGTTGGGCAAACTTGCTTTTGG - Intronic
1104884277 12:132096115-132096137 CAGTAGGGACTACCTGCCTCAGG + Intronic
1109687809 13:65843992-65844014 ACGTTGGGACAACCTGCCTGTGG + Intergenic
1112958813 13:105095888-105095910 CATTTGGGACAACTCACATTAGG + Intergenic
1113445948 13:110366990-110367012 CAGTGGGGACATATGGCCTTTGG - Intronic
1115964684 14:38874602-38874624 AAGTTGGAACAACTTGGCATAGG + Intergenic
1116490708 14:45499581-45499603 GATTTGGGACAAGTTGCATTGGG + Intergenic
1118144725 14:63123178-63123200 CTGTTGGGAGAAGTTGCCCTTGG + Intergenic
1118528988 14:66680417-66680439 CAGTTGGGAGAACAGGCCATGGG - Intronic
1120618144 14:86732870-86732892 GATTTGGGACAAGTTGCATTCGG - Intergenic
1120890219 14:89484890-89484912 CACTTTGGAGAACGTGCCTTGGG + Intronic
1121685853 14:95834511-95834533 CAGTTTAGACAATTTGCCCTGGG + Intergenic
1122381447 14:101309845-101309867 GATTTGGGACAAGTTGCATTGGG + Intergenic
1124664040 15:31576506-31576528 AAGGTGGGACAACTTGACCTGGG - Intronic
1128235997 15:66067561-66067583 CAGGTGGGACCCTTTGCCTTTGG + Intronic
1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG + Intergenic
1130932193 15:88437592-88437614 CAGTTGCCAAAACATGCCTTTGG + Intergenic
1134505007 16:14798056-14798078 TTATTGAGACAACTTGCCTTGGG + Intronic
1134575567 16:15330853-15330875 TTATTGAGACAACTTGCCTTGGG - Intergenic
1134726878 16:16425647-16425669 TTATTGAGACAACTTGCCTTGGG + Intergenic
1138891228 16:61146315-61146337 CAGTTGAGACAACATACCTTTGG - Intergenic
1142163607 16:88572548-88572570 CAGATGGGTGAACTTGCCTAAGG - Intronic
1152184446 17:78845350-78845372 TAGTTGGGACCTCTTGCCTGTGG - Intergenic
1155169717 18:23258392-23258414 CAGCTGGGACAAACTGCGTTTGG + Exonic
1155173705 18:23285586-23285608 GATTTGGGACAAGTTGCATTGGG - Intronic
1155304863 18:24469177-24469199 CAGTTGGGACAACTTGCCTTGGG - Intronic
1160024510 18:75207139-75207161 CTGGTGGGACCACCTGCCTTTGG - Intronic
1160157912 18:76447482-76447504 GAGTTGGAACAACTTGTATTTGG - Intronic
1161868239 19:6850533-6850555 CTGTTGGGACAGCTTGTCTTTGG + Intronic
1163221571 19:15925179-15925201 CAGTTAGGACAACATGCTTTGGG + Intronic
1164604732 19:29589534-29589556 CATTTGGGCCAAGTTTCCTTGGG - Intergenic
1168045738 19:53793017-53793039 AACTTGGCACAATTTGCCTTTGG + Intergenic
926977462 2:18529617-18529639 GAGTTTGGAGAACTTGCTTTAGG - Intergenic
926999447 2:18777534-18777556 CAATTGGGACAAATTGACTCAGG + Intergenic
931148883 2:59550690-59550712 CAGTTGGGATGACCTGCCTCTGG + Intergenic
932295744 2:70622182-70622204 GATTTGGGATAACTTGCATTGGG - Intronic
935200433 2:100852072-100852094 CAGGTTAGATAACTTGCCTTGGG + Intronic
935731624 2:106068965-106068987 AAGATGGGACAAATGGCCTTGGG - Intronic
938216687 2:129523498-129523520 CAGGGCTGACAACTTGCCTTGGG + Intergenic
940726546 2:157342302-157342324 GATTTGGGACAAGTTGCATTGGG + Intergenic
942096976 2:172543274-172543296 GATTTGGGACAAGTTGCATTGGG - Intergenic
944040622 2:195349839-195349861 CAGTTGAGAGAACTGGCCTTTGG - Intergenic
946495618 2:220192645-220192667 TCTTTGGGACAACTTGCCTGTGG + Intergenic
946563140 2:220935614-220935636 CAGGTGGGAAAATTTGTCTTTGG + Intergenic
947741142 2:232485531-232485553 CAGTTGGGACCCCTAGCTTTGGG + Intronic
1171992190 20:31705072-31705094 CAGGTAGGACAAGTTGGCTTTGG + Intronic
1178165509 21:29970872-29970894 CAGTTGAGACAACATGGCTCAGG + Intergenic
1179015401 21:37591193-37591215 GATTTGGGACGACTTGCATTGGG + Intergenic
949671039 3:6399203-6399225 GATTTGGGACAAGTTGCATTGGG - Intergenic
949827326 3:8178566-8178588 GATTTGGGACAAGTTGCATTGGG - Intergenic
952239383 3:31514427-31514449 CAGTTTGGCCAACTTGCCACGGG - Intergenic
952750989 3:36824739-36824761 CAGATGATACAACTTGCCCTGGG - Intergenic
953015780 3:39074742-39074764 CTGATGGGACAATTCGCCTTTGG + Exonic
955468359 3:59259604-59259626 CAGTTGGTAGAACATGGCTTTGG + Intergenic
956306182 3:67828973-67828995 CAATTGGCACAACTTGCTTATGG - Intergenic
956621569 3:71226385-71226407 CAGTTTGGGCTACTTGCCTCAGG + Intronic
956709104 3:72024524-72024546 GATTTGGGACAAGTTGCATTGGG - Intergenic
956752983 3:72359665-72359687 CAGTTTTTACAACTTGGCTTAGG - Intergenic
960323930 3:116271583-116271605 CAGTTGGGGCCACATGCTTTAGG + Intronic
963406775 3:144875005-144875027 CAGTTGCAACAACATGCATTAGG - Intergenic
965782419 3:172300658-172300680 CATTTGGGACTCCTTGCATTTGG + Intronic
976709723 4:88056206-88056228 CAGTTGGCATACCTTGTCTTTGG + Exonic
977308238 4:95352049-95352071 CAGTTGGGATGAGATGCCTTGGG - Intronic
980284839 4:130768893-130768915 GATTTGGGACAAGTTGCATTGGG - Intergenic
980491468 4:133533341-133533363 GATTTGGGACAAGTTGCATTGGG + Intergenic
983715491 4:170776675-170776697 TCGTTGGGACACCTTGCCTCTGG + Intergenic
984095698 4:175429931-175429953 CAGTTGGGTGCACTTGCCTGAGG + Intergenic
984099160 4:175465585-175465607 GATTTGGGACAAGTTGCATTGGG + Intergenic
984169412 4:176343150-176343172 AGGATGGGACAACTTGCCTGTGG - Intergenic
984170987 4:176358995-176359017 AAGTTGGGACAACTTGAATTGGG + Intergenic
985079132 4:186246357-186246379 GATTTGGGACAAGTTGCATTGGG + Intronic
986502469 5:8415266-8415288 GATTTGGGACGACTCGCCTTGGG - Intergenic
993580518 5:89654266-89654288 GAGTGGAGACAACATGCCTTGGG + Intergenic
993825471 5:92680339-92680361 CAATTGGGTCTACTGGCCTTTGG + Intergenic
994324706 5:98435758-98435780 GATTTGGGACAAGTTGCATTGGG - Intergenic
995146053 5:108787733-108787755 TTGTTGGGACAACCTGCCTGTGG + Intronic
995927054 5:117386721-117386743 TTGTTGGGACAACCTGCCTGCGG + Intergenic
996527938 5:124498568-124498590 AATTTGGGACAAGTTGCATTGGG - Intergenic
996575123 5:124970798-124970820 GATTTGGGACGAGTTGCCTTGGG + Intergenic
996690033 5:126330527-126330549 GAGTCAAGACAACTTGCCTTTGG - Intergenic
997758347 5:136421459-136421481 CTGTTGGGACTGCATGCCTTAGG - Intergenic
1000935756 5:167302065-167302087 GATTTGGGACAAGTTGCATTGGG + Intronic
1001354635 5:171007571-171007593 GATTTGGGACAAGTTGCATTGGG + Intronic
1004372300 6:15063092-15063114 CAGTTGGGATAACCAGCCGTGGG + Intergenic
1006917499 6:37603943-37603965 CAGTTGGGACAGCTTGATTTGGG + Intergenic
1007165330 6:39824933-39824955 CAGTTGGGATAACCTGGCTCTGG - Intronic
1007587265 6:42999098-42999120 CAGATTGGCCAAGTTGCCTTTGG + Intronic
1008758540 6:54826427-54826449 AAGTTGGGAAAAATTGCATTTGG + Intergenic
1010335290 6:74674521-74674543 CATTTCTGACAACTTCCCTTAGG + Intergenic
1010335295 6:74674615-74674637 CATTTCTGACAACTTCCCTTAGG + Intergenic
1010519739 6:76818210-76818232 TTGTTGGGATGACTTGCCTTTGG + Intergenic
1010922743 6:81704171-81704193 CTGTTGGAACAACTTGACTTAGG + Intronic
1011528004 6:88287576-88287598 AGCTTGGGACAACTTGCCTGTGG - Intergenic
1015165106 6:130193877-130193899 GATTTGGGACAAGTTGCATTGGG - Intronic
1015278040 6:131404371-131404393 GATTTGGGACAAGTTGCATTGGG - Intergenic
1015313243 6:131788139-131788161 CACTTGGGACTACTTCACTTGGG - Intergenic
1018363824 6:163098538-163098560 CAGTTGGGACAACTGGCTTTTGG + Intronic
1018869918 6:167774487-167774509 CAGTTGGCACCACTTGCATCTGG + Intergenic
1022423397 7:30245708-30245730 TCATTGGGACAACTTGCCTGTGG - Intergenic
1022708947 7:32833906-32833928 GATTTGGGACAAGTTGCATTGGG - Intergenic
1024825967 7:53389615-53389637 CAGTTGCGTGAACTTGACTTTGG - Intergenic
1027487173 7:78776030-78776052 GAGTTTGGATGACTTGCCTTTGG - Intronic
1031360451 7:120843504-120843526 CAGTTTGAACAATTGGCCTTGGG - Intronic
1032572428 7:133014481-133014503 CTGCTGGGACAATTTGCCGTTGG - Intronic
1033465160 7:141582989-141583011 GATTTGGGACAAGTTGCATTGGG + Intronic
1033977166 7:147116513-147116535 CAGCTGGGACAACCTGCCCTGGG + Intronic
1034084944 7:148314226-148314248 GATTTGGGACAAGTTGCATTGGG + Intronic
1037236883 8:16730776-16730798 GAGTTGACAGAACTTGCCTTTGG - Intergenic
1037294771 8:17388676-17388698 TATTTGGCACAACTTGCCCTTGG - Intronic
1041781144 8:61579265-61579287 CAGCTCGGACAACTTGGCGTTGG - Intronic
1041797466 8:61760474-61760496 GAGTTGGGAGAATTTGACTTTGG - Intergenic
1042198719 8:66258557-66258579 CAGTTTGAACAGCTTCCCTTAGG + Intergenic
1043180553 8:77082708-77082730 TTGTTGGGACAACCTGCCTGTGG - Intergenic
1043837614 8:85064488-85064510 GATTTGGGACAAGTTGCATTGGG - Intergenic
1044109135 8:88249853-88249875 CAGTTGGGCCCTCTTGCTTTGGG - Intronic
1046294009 8:112197380-112197402 GATTTGGGACAAGTTGCATTGGG - Intergenic
1048728533 8:137412456-137412478 GATTTGGGACAAGTTGCATTGGG + Intergenic
1051160980 9:14207151-14207173 CAGATGAGAAAACTTGCCTAAGG + Intronic
1051453469 9:17224508-17224530 CAGTTGAGACAAGTTTCTTTGGG - Intronic
1052708015 9:32016426-32016448 TAGTTGGGACACCTTGGCTGTGG - Intergenic
1059822704 9:117991779-117991801 TATTTGACACAACTTGCCTTGGG + Intergenic
1060027390 9:120184762-120184784 CACCTTGGACAACTTGCCTTTGG - Intergenic
1060105417 9:120869991-120870013 CCTTTGGGCCAACTGGCCTTGGG - Intronic
1060342203 9:122787690-122787712 TAGTAGGGACATCTTTCCTTTGG - Intergenic
1060772334 9:126341607-126341629 AAGTTGGGAAACCCTGCCTTAGG - Intronic
1061471755 9:130832378-130832400 CTGTTGGGAAAACATGTCTTAGG - Intronic
1061518643 9:131104273-131104295 CAGCCGGGAAAACTTGTCTTTGG + Intronic
1061582942 9:131548596-131548618 GATTTGGGACAAGTTGCATTGGG - Intergenic
1185830486 X:3297683-3297705 GAGTTTGAACAGCTTGCCTTTGG - Intergenic
1186602439 X:11052519-11052541 CCGTTGGGACACACTGCCTTAGG + Intergenic
1189753466 X:44247066-44247088 CAGTTGGGCATATTTGCCTTGGG - Intronic
1189893782 X:45632671-45632693 CAGCTCGGACAACTTGGCCTTGG + Intergenic
1190621171 X:52288241-52288263 TTGTTGGGACAACCTGCCTGCGG + Intergenic
1190621209 X:52288451-52288473 TTGTTGGGACAACCTGCCTGCGG + Intergenic
1194532784 X:95071809-95071831 CAGTGCTGAGAACTTGCCTTAGG - Intergenic
1195199975 X:102539354-102539376 TAGTTGGTACAGCTTGCCTTGGG - Intergenic
1196221093 X:113112876-113112898 GATTTGGGACGAGTTGCCTTGGG + Intergenic
1198175002 X:134146283-134146305 CAGTTGTGCTAACTTGCCTCTGG + Intergenic
1198733498 X:139760149-139760171 GAGATGGTATAACTTGCCTTTGG - Intronic
1201247436 Y:12019203-12019225 GAGTTTGAACAGCTTGCCTTTGG + Intergenic
1201552091 Y:15228341-15228363 CAATTGTGAAAACTTGACTTAGG - Intergenic