ID: 1155307305

View in Genome Browser
Species Human (GRCh38)
Location 18:24490883-24490905
Sequence CAGAGCCACGACTCAAAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 1, 2: 1, 3: 17, 4: 214}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155307298_1155307305 16 Left 1155307298 18:24490844-24490866 CCCAGAAGGTCCACGTGGTGGAC 0: 1
1: 0
2: 0
3: 2
4: 58
Right 1155307305 18:24490883-24490905 CAGAGCCACGACTCAAAAGAGGG 0: 1
1: 1
2: 1
3: 17
4: 214
1155307299_1155307305 15 Left 1155307299 18:24490845-24490867 CCAGAAGGTCCACGTGGTGGACA 0: 1
1: 0
2: 0
3: 3
4: 74
Right 1155307305 18:24490883-24490905 CAGAGCCACGACTCAAAAGAGGG 0: 1
1: 1
2: 1
3: 17
4: 214
1155307302_1155307305 6 Left 1155307302 18:24490854-24490876 CCACGTGGTGGACAAGGGCAAGT 0: 1
1: 0
2: 1
3: 3
4: 79
Right 1155307305 18:24490883-24490905 CAGAGCCACGACTCAAAAGAGGG 0: 1
1: 1
2: 1
3: 17
4: 214
1155307296_1155307305 19 Left 1155307296 18:24490841-24490863 CCACCCAGAAGGTCCACGTGGTG 0: 1
1: 0
2: 0
3: 7
4: 122
Right 1155307305 18:24490883-24490905 CAGAGCCACGACTCAAAAGAGGG 0: 1
1: 1
2: 1
3: 17
4: 214
1155307295_1155307305 20 Left 1155307295 18:24490840-24490862 CCCACCCAGAAGGTCCACGTGGT 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1155307305 18:24490883-24490905 CAGAGCCACGACTCAAAAGAGGG 0: 1
1: 1
2: 1
3: 17
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155307305 Original CRISPR CAGAGCCACGACTCAAAAGA GGG Intergenic
901806463 1:11741620-11741642 CAGAGCCAGGACTCAAACCCAGG - Intronic
902597123 1:17517000-17517022 CAGAGCCAGGACTCAAATCTGGG + Intergenic
903795240 1:25923430-25923452 CACAGCAAGGACTCAAAAGTTGG - Intergenic
903827953 1:26158785-26158807 CAGAGCCAGGACTCCAAACAAGG - Intergenic
905788491 1:40776645-40776667 CAGGGCCAGGACTCTAAGGAGGG - Intergenic
906436673 1:45802565-45802587 CAGAGCCAGGACTCAAACCCAGG - Intronic
907268323 1:53276062-53276084 GAGCACCAAGACTCAAAAGAAGG - Intronic
907331570 1:53675320-53675342 CTGAGCCACATCTCTAAAGATGG - Intronic
907681760 1:56570624-56570646 CAGTGCCAACATTCAAAAGAAGG - Intronic
908477876 1:64506568-64506590 CAGAGCCAGGAGTCAAAACCAGG + Intronic
908557284 1:65268593-65268615 CAGAGCCATGATTCAAAATCAGG + Intronic
910123877 1:83819402-83819424 CAGAGCAACCACTCACTAGAGGG + Intergenic
910273925 1:85428153-85428175 CAGAACCAAGACTCAGAAGAAGG + Intronic
910359725 1:86403675-86403697 GAGAGCCACCACTGAAAAGTTGG + Intergenic
910553335 1:88501227-88501249 CTGAGCTGAGACTCAAAAGATGG + Intergenic
911177449 1:94831366-94831388 CAGTGCCAAGACTGAAAAGCTGG + Intronic
912420394 1:109538784-109538806 CAGAGCCATGAGTCTAAACAGGG - Intergenic
913531007 1:119734314-119734336 CACAGCCAGAGCTCAAAAGAAGG - Intronic
916054858 1:161061634-161061656 TAGAGCCATGACTCAAATCAAGG + Intronic
916324205 1:163539020-163539042 CAGAGCCAGGTCTCAAACGGAGG - Intergenic
916453988 1:164951737-164951759 CAGAGCAACAACCCAAAAAAAGG + Intergenic
919429416 1:197474313-197474335 CAGAGCCACGAATCAAACCCAGG + Intronic
919941560 1:202290507-202290529 CAGAGCCAGGACTCAAACTCAGG - Intronic
920244583 1:204578132-204578154 CAGAGCCAAGACTCAAACCAGGG + Intergenic
920637109 1:207714284-207714306 CAAAGCCACCACTCAAAGGTGGG + Intronic
920847631 1:209607130-209607152 CAGAGCTCTGACTCAAGAGAGGG + Intronic
1068416323 10:56727663-56727685 AACAGACACTACTCAAAAGAAGG - Intergenic
1071561288 10:86648760-86648782 CAGAGCCACGGCTCCAAGGAGGG - Intergenic
1072211034 10:93247263-93247285 CAGAGCCAAGTCTCAAACAAAGG - Intergenic
1073079516 10:100850093-100850115 CTGAGCCTTGACTCAAATGAGGG + Intergenic
1076292685 10:129359932-129359954 CACAGCCACGACTGACAAGAAGG + Intergenic
1077995452 11:7448812-7448834 TGAAGCCACGACTGAAAAGAGGG - Intronic
1078972981 11:16436571-16436593 CAGAGCCAGGACTTAAAATTAGG - Intronic
1079079146 11:17401895-17401917 CAGAACTAGGACTCAAAGGAGGG - Intronic
1080376225 11:31715839-31715861 CAGAGCAAGCACTCAATAGACGG + Intronic
1080985515 11:37459262-37459284 CAGAGCCAGGACTTGAATGAAGG + Intergenic
1081671080 11:44943035-44943057 CAGAGCCAAGACTCAAACCCAGG - Intronic
1083106239 11:60361061-60361083 CAAAGACACCACTCAAAAGTGGG + Intronic
1084682180 11:70672875-70672897 CAGAGCCAGGACTAGAAAGTGGG - Intronic
1087002954 11:93439876-93439898 AAGAGACACTTCTCAAAAGAAGG - Intergenic
1089323415 11:117641643-117641665 GAGGGCCCCGACTCAGAAGAGGG + Intronic
1089801117 11:121028481-121028503 CAGAGCCAGGACTCAAATCTAGG - Intronic
1090302178 11:125652246-125652268 CAGTGCCAAGACTCCAAATATGG - Intronic
1090516281 11:127431218-127431240 CACAGACACTTCTCAAAAGAAGG - Intergenic
1090833076 11:130433052-130433074 CACAGCAAGCACTCAAAAGATGG - Intergenic
1093566959 12:20618303-20618325 CAGGGCTAAAACTCAAAAGAAGG - Intronic
1093955557 12:25214204-25214226 AAGAGCCAAGACTCAAGGGAAGG + Intronic
1094668587 12:32546452-32546474 CAAAGCCACGAGTCACAACAGGG - Intronic
1095881380 12:47141086-47141108 CAAAGCCAGGACTCAAATCATGG - Intronic
1097947459 12:65387595-65387617 CAGAGCCAGGATTCAAATGATGG - Intronic
1102043952 12:109818082-109818104 CAGAGCCAGGACTGAAATGCGGG + Intronic
1102659401 12:114512831-114512853 CAGAGCCAGGACTAAAAACCAGG - Intergenic
1105422967 13:20269391-20269413 CAGAACCACGGCTCAGATGAAGG - Intergenic
1106572751 13:30942318-30942340 AACAGCCATGTCTCAAAAGAAGG - Intronic
1106947015 13:34840085-34840107 CTGAGGCAAGACACAAAAGAGGG + Intergenic
1107257966 13:38453425-38453447 GAGACCTACTACTCAAAAGAGGG + Intergenic
1109492870 13:63126587-63126609 CAAAGGCACCACTCAAAAGTGGG - Intergenic
1109600305 13:64618355-64618377 AAGACCCACTACACAAAAGAAGG + Intergenic
1111310005 13:86472143-86472165 CAAAGCCACCACTCAAAGGTGGG + Intergenic
1114874974 14:26705229-26705251 CAGAGCCATGTTTCAAAACAAGG - Intergenic
1115668135 14:35576796-35576818 CAGAGCCAGGATTCAAACCAAGG + Intronic
1115725047 14:36204844-36204866 CAGAGCCACGACTCAACACAAGG + Intergenic
1116435985 14:44896249-44896271 CAGAGCCAAAACTCAAGAAATGG + Intergenic
1117336402 14:54760320-54760342 CAGAGCCCCGACTGCAAAGATGG + Exonic
1118334472 14:64841251-64841273 CAGAGCCAGGATTCAAACGCAGG + Intronic
1118882646 14:69842446-69842468 CAGAGCCAGGAATCAAACGTAGG + Intergenic
1119537611 14:75415564-75415586 CAGAGCCAGGACTCAAACCCAGG - Intergenic
1120250587 14:82058246-82058268 CAGATCCAGGAATCAAAGGATGG - Intergenic
1121328443 14:93035013-93035035 AAGAGGCAGGACCCAAAAGAAGG - Intronic
1121907756 14:97762818-97762840 CAGAGCTGAGACTCAAAAGAGGG - Exonic
1122392910 14:101402531-101402553 CAGAGCCAGGACCCAAACGCAGG - Intergenic
1123818561 15:24003552-24003574 CTGAACCATGAATCAAAAGATGG - Intergenic
1123837687 15:24212569-24212591 CTGAACCATGAATCAAAAGATGG - Intergenic
1125364830 15:38902700-38902722 CATAAGCACGACTCAAAAGAAGG + Intergenic
1125419300 15:39488116-39488138 CAGAGCCAAGACTCAAACCCTGG + Intergenic
1128569073 15:68720190-68720212 CAGAGCCAGGATTCAAATGCAGG - Intronic
1129226030 15:74170965-74170987 CAGGGCCAGGACTCACAGGAGGG + Intergenic
1129882438 15:79016315-79016337 CAAGGCCACGACCCCAAAGAGGG + Intronic
1130231215 15:82098673-82098695 CAGAGCCAGGACTCAGAAGCAGG - Intergenic
1130810671 15:87374805-87374827 CAGAGCCATCAGGCAAAAGAAGG + Intergenic
1131871379 15:96768379-96768401 CTTAGCCACTACTCAAGAGAGGG - Intergenic
1132660389 16:1058433-1058455 CACAGCCACGCCACAAGAGAAGG + Intergenic
1133218387 16:4307350-4307372 TTGAGTCAAGACTCAAAAGAGGG - Intergenic
1135040181 16:19112449-19112471 GGGAACCAGGACTCAAAAGATGG - Intergenic
1136864639 16:33736586-33736608 TAGAGCCACGAATAAAAATAAGG + Intergenic
1137570548 16:49563614-49563636 CAGAGCCCAGACTCAAACCAAGG + Intronic
1139215010 16:65119313-65119335 CACAGCCACCACTCTACAGAGGG + Intronic
1139971322 16:70777443-70777465 CAGAGCCAGGACTCATAGGCAGG + Intronic
1141669542 16:85484709-85484731 CAGAGCCCCGACTCAAAACCAGG + Intergenic
1142871719 17:2825530-2825552 CAGAGCCAGGATTCAACAAAGGG - Intronic
1142980836 17:3670358-3670380 CAGAGCCAGGATTCAAATGCAGG + Exonic
1145901862 17:28494942-28494964 CAGAGCCTCCATCCAAAAGAGGG + Intronic
1146458405 17:33024806-33024828 CAGAGCGAGGACTCAGTAGATGG - Intronic
1149432617 17:56606324-56606346 CAAAGCCAGGACTCAAAACCAGG + Intergenic
1155098923 18:22589597-22589619 CATAGACAGGAATCAAAAGAAGG + Intergenic
1155281178 18:24241474-24241496 AAGAGACACTTCTCAAAAGAAGG + Intronic
1155307305 18:24490883-24490905 CAGAGCCACGACTCAAAAGAGGG + Intergenic
1156952050 18:42913348-42913370 CAAAGCCACAATTCATAAGAGGG + Intronic
1158129053 18:54132626-54132648 CAGAGCCAGGATTCAAAACTAGG - Intergenic
1158509632 18:58079140-58079162 CTGAGCCAAGACTCCCAAGAAGG - Intronic
1159177809 18:64861187-64861209 CAGAGCCAAGAATCAAACGTAGG + Intergenic
1160422178 18:78754772-78754794 GAGAGCCACATCTCAGAAGAAGG - Intergenic
1161311950 19:3599833-3599855 CAGAGCCCCTACTCACCAGAAGG + Exonic
1162532854 19:11245836-11245858 CAGAGCCAAGATCCCAAAGATGG + Exonic
1162766698 19:12924269-12924291 CAGAGGCAGGACAGAAAAGACGG + Intronic
1165638528 19:37364249-37364271 CAAAGGCACCACTCAAAAGGTGG - Exonic
1166121455 19:40689877-40689899 CACAGCCACTTCTCAAAACAAGG - Intronic
1167236228 19:48317517-48317539 CAGAGCCAGGACTCTAATGCAGG + Intronic
1167662999 19:50807388-50807410 CAGAGCCTGGACTCAAAACCAGG + Intergenic
925326189 2:3023797-3023819 CAGAGCCAAGCTGCAAAAGATGG + Intergenic
925692660 2:6540762-6540784 CAGAGCCAGAACTCAAACCAAGG + Intergenic
926677902 2:15641962-15641984 CAGAGCCAAGATTCCAAAGCAGG + Intergenic
926996663 2:18742713-18742735 CAGAGCCATGAGTTAAAACATGG + Intergenic
929464397 2:42131779-42131801 CAGAGCCAGGACTCAAACACAGG + Intergenic
932758380 2:74424039-74424061 CAGAGCCAAGACTCAAAGCCAGG - Intronic
932830458 2:74984941-74984963 GAGAGCCAGGATTCAAAAGCTGG + Intergenic
933310813 2:80659404-80659426 CAGAGCCAGGAATCAAAATCAGG + Intergenic
935952879 2:108346740-108346762 AATAGTCACAACTCAAAAGAAGG + Intergenic
937731405 2:125235200-125235222 AAGAGACACTTCTCAAAAGAAGG - Intergenic
940258489 2:151757239-151757261 CTGAGCCCCTACCCAAAAGAGGG + Intergenic
944163870 2:196696103-196696125 CACAGCCAAAACTCAAAAGTAGG - Intronic
944610276 2:201397132-201397154 CAGAGCCAGGGCTTAAATGATGG - Intronic
944622863 2:201535847-201535869 CAAAGCCAAGACCCAAAAGAAGG - Intronic
946001693 2:216487678-216487700 CAGAGCAACCACTCACAAGGGGG - Intergenic
946517927 2:220433609-220433631 CAGAGCCAGGATTCAAACCAGGG - Intergenic
946613005 2:221479233-221479255 CAGAGCCAGTACTAAAAAGCAGG - Intronic
946717591 2:222569087-222569109 CAGAGCCTCGACTCATGAGCTGG + Intergenic
1170408034 20:16060076-16060098 CACAGCTATGACTCAAAGGAGGG - Intergenic
1172858877 20:38031760-38031782 CAGAGCCAGGAGTCAAATTAGGG - Intronic
1173089346 20:39955441-39955463 CAGAGCCACAACTCAAAAGAGGG - Intergenic
1173553230 20:43947969-43947991 CAGAGCCATGACTTAAAACAAGG - Intronic
1175345182 20:58268013-58268035 CACAGCGACAACTCAAAAAAGGG + Intergenic
1176971245 21:15268485-15268507 CAGAGCTAGGATTCAAAAGTAGG + Intergenic
1177342208 21:19818157-19818179 CACATCCACAACTCAAAATATGG + Intergenic
1178137291 21:29641868-29641890 CAGAGACACGAGTCCAAAGCAGG + Intronic
1179139940 21:38716493-38716515 CAGAGCCGAGAATCAGAAGAAGG + Intergenic
1180711240 22:17841160-17841182 GAGAGCCAAGAATCAAAAGGGGG - Intronic
1183105200 22:35610472-35610494 CAGAGCCAAGATTCAAACGCAGG - Intronic
1183382281 22:37496194-37496216 CAGAGCCAGGACTCAAACCCAGG + Intronic
1184900441 22:47443520-47443542 CAGAGCTGGGACTCAAAACAGGG - Intergenic
949222342 3:1650735-1650757 AACAGACACGTCTCAAAAGAAGG - Intergenic
949480086 3:4485350-4485372 CAGAGAAACTACTCAGAAGAAGG + Intergenic
950108934 3:10406136-10406158 TATAGCCAGGACTCAAACGAGGG + Intronic
950572485 3:13810051-13810073 CAGAGTCAGGACTCAAACCAAGG - Intergenic
955548931 3:60062012-60062034 CAGAGACCTGACTCAAAATAAGG + Intronic
955660147 3:61290096-61290118 CAGAGCCAGGACTCAAACTCAGG - Intergenic
955736196 3:62040985-62041007 CAGAGCCAGGACTCAAAGTTTGG - Intronic
957408654 3:79807378-79807400 CTGAGCTAGGACTCAAAAGTGGG + Intergenic
959648994 3:108733579-108733601 AAGAGCCACGGCTCAGAATAGGG + Intergenic
961652272 3:128422520-128422542 CAGGGCCACGCCTCAACACAGGG + Intergenic
962823875 3:139081159-139081181 CAAAGCCATGACTGAAAAGTTGG + Intronic
963381809 3:144539938-144539960 CAGAGCAACAGGTCAAAAGAGGG + Intergenic
963643979 3:147890905-147890927 CCAAGCCAAGAATCAAAAGAAGG + Intergenic
964949011 3:162263866-162263888 CAGAGACAGTACTAAAAAGAGGG + Intergenic
966661490 3:182419558-182419580 AATAGACACTACTCAAAAGAAGG + Intergenic
967327610 3:188257863-188257885 CAGAGCCAGGATTCAAATGTTGG + Intronic
974085661 4:57257992-57258014 CACAGACACTTCTCAAAAGAGGG - Intergenic
974281414 4:59799514-59799536 CAGAGCAACCAGACAAAAGAAGG - Intergenic
975735027 4:77372685-77372707 CAGAGCTACAACTCACAAGTGGG - Intronic
978095514 4:104771151-104771173 CAGAGCCACGTCTCCAATTAAGG - Intergenic
978140846 4:105316112-105316134 AAGAGACACTTCTCAAAAGATGG + Intergenic
978859691 4:113433441-113433463 CAGAGCCACAATTTAAAAGAAGG + Intergenic
980698308 4:136389631-136389653 CAGAGCCAGGATTCCAAAGTAGG - Intergenic
981711853 4:147716765-147716787 GAGAACCAAGACTCAGAAGAAGG + Intergenic
982644741 4:158009423-158009445 CAGATCCAGGCCCCAAAAGAGGG + Intergenic
983110090 4:163738931-163738953 CATACCCAAGACTGAAAAGAAGG + Intronic
984740200 4:183154207-183154229 CAGAGCCAGGATTCAAATGCAGG - Intronic
989065250 5:37453815-37453837 CTGAAACATGACTCAAAAGAAGG - Intronic
994144209 5:96374633-96374655 ATGAGACAGGACTCAAAAGATGG - Intergenic
994419064 5:99509636-99509658 CTGAGACATGACTCAAAAGAAGG - Intergenic
996913761 5:128686135-128686157 CAGATCCTTGACTCAAAAGCAGG + Intronic
997138906 5:131357455-131357477 CAAAGCCACGACTCTAAACCTGG - Intronic
997481836 5:134191395-134191417 CAGAGCCAAGACTAAAATTAAGG + Intronic
998992057 5:147828288-147828310 CAGAGGCATGACTTAAAACAAGG - Intronic
999056558 5:148584313-148584335 CAGAGCCAGGACTAGACAGATGG + Intronic
999610691 5:153366145-153366167 CTGAGCCAAGACTTCAAAGAAGG + Intergenic
1000128404 5:158270266-158270288 CACAGACACTTCTCAAAAGAAGG - Intergenic
1000156771 5:158560021-158560043 CAGAGCCATGATTCAAAACCAGG + Intergenic
1000431133 5:161153851-161153873 CAGAGCCAAGATTTAAAAGCAGG + Intergenic
1001279909 5:170379219-170379241 CAGAGCCAGGACTCCAAGGTAGG - Intronic
1003883327 6:10498047-10498069 TAGAACCACGTCTCAAAAGCAGG - Intronic
1005136359 6:22572842-22572864 CAAAGCCAAGATTCAAAAGCAGG + Intergenic
1005815808 6:29551797-29551819 CAGAGCCAGGACTCAAACCCAGG + Intergenic
1007054229 6:38865952-38865974 CAGACCCAAGTCTCAAAGGAAGG - Intronic
1007518179 6:42429940-42429962 CTGAGCCAAGACTTGAAAGAGGG + Intronic
1007785820 6:44278603-44278625 CAGAGCCTGGTCTCACAAGAGGG + Exonic
1009274427 6:61657043-61657065 AAGTGCAACTACTCAAAAGATGG + Intergenic
1010140944 6:72613980-72614002 CTGAGCCATGACTCAAAAAGAGG + Intergenic
1010334668 6:74666462-74666484 CAAAGCCAGGATTCAAGAGAAGG + Intergenic
1010722617 6:79300999-79301021 CTGAGCCCAGACTCAAAAGGGGG - Intergenic
1012424032 6:99094881-99094903 CTGAGCCAGGACTAGAAAGATGG + Intergenic
1015892756 6:137984959-137984981 AACAGCCACTTCTCAAAAGAAGG - Intergenic
1017058715 6:150460717-150460739 CAGAGCCAGGACTCAAATTGAGG + Intergenic
1019127944 6:169853731-169853753 CAGACACACGACCCAAGAGAAGG - Intergenic
1021579023 7:22132919-22132941 CAGAGCCAGGATTCAAACAAAGG + Intronic
1022129338 7:27389852-27389874 CAGAGCCACTACTAAAACAATGG - Intergenic
1023497436 7:40813551-40813573 AAGATCCACCACACAAAAGAAGG - Intronic
1024636711 7:51297040-51297062 CAGAGAGGGGACTCAAAAGAGGG - Intronic
1028999631 7:97139422-97139444 CAAAGGCACCACTCAAAAGTAGG + Intronic
1030133176 7:106220286-106220308 CAGAGCCATGACTCAAACCCAGG - Intergenic
1030925091 7:115441967-115441989 CAGAACCAGGACTCAAACAAAGG - Intergenic
1031416724 7:121504412-121504434 CAGATCCACGTCTCAAGAGAGGG - Intergenic
1031622125 7:123946714-123946736 CTGATCAAGGACTCAAAAGAAGG - Intronic
1033193524 7:139306487-139306509 CATAGCCAAGACTCAAAAATAGG - Exonic
1034951620 7:155300799-155300821 CAGAGCCACGTCCCATCAGAGGG + Intronic
1035107952 7:156457897-156457919 CAGGACCAGGATTCAAAAGAAGG + Intergenic
1035134559 7:156688645-156688667 CAGAGACCCGACTAAAGAGAGGG - Intronic
1037301941 8:17461079-17461101 CAAAGACACCACTCAAAAGTGGG + Intergenic
1040679344 8:49789875-49789897 CAGATCCAGGAATCAAGAGATGG + Intergenic
1042629218 8:70798349-70798371 AAGAGACACTTCTCAAAAGAAGG - Intergenic
1044381616 8:91541037-91541059 CAGAGTCACTGCTCAAAATATGG + Intergenic
1044598677 8:93982284-93982306 CAGAGTTAGGACTCAAAAGCAGG + Intergenic
1044778785 8:95722364-95722386 GAGAGCCAACACCCAAAAGAAGG + Intergenic
1045515533 8:102856573-102856595 AAGAGACACGAATTAAAAGAAGG + Intronic
1046527963 8:115405496-115405518 TTGAGCCAAGACTTAAAAGAGGG - Intergenic
1047646787 8:126878245-126878267 CCGAGACATGTCTCAAAAGAGGG + Intergenic
1049356564 8:142192158-142192180 CAGAGCCAGGACTCAAACCCAGG + Intergenic
1050939682 9:11443161-11443183 CAAAGACACCACTCAAAAGTCGG - Intergenic
1059710574 9:116864290-116864312 CAGAGCCAAGACACAAACGCAGG + Intronic
1059951757 9:119471227-119471249 CAGAGCAATTAGTCAAAAGAAGG - Intergenic
1061635103 9:131902908-131902930 CAGAGCCAAGACACAAATGCAGG - Intronic
1187546655 X:20260876-20260898 CAGAGCCAGGACTCAAACACAGG + Intronic
1189520563 X:41762987-41763009 CAGATCCCTGATTCAAAAGAAGG + Intronic
1190874405 X:54449408-54449430 CAGAGCCAGGACTTAAAGGCAGG - Intronic
1192276782 X:69640108-69640130 CAAAGCCAAGAATCAAAAGCAGG - Intronic
1194267665 X:91775480-91775502 CAGAGCCAAGACTCCAAATTTGG + Intergenic
1196120853 X:112049031-112049053 CAGAGCCAGGACTCAATAGCAGG - Intronic
1197647110 X:129029798-129029820 ATGAGCCAGGAATCAAAAGAGGG + Intergenic
1197962096 X:132018026-132018048 CAGCGGCAGGAGTCAAAAGATGG - Intergenic
1198691709 X:139292079-139292101 CAGAGCCATGACTCAGAAACTGG + Intergenic
1199758391 X:150886609-150886631 GAGAACCACGACTGTAAAGACGG - Intronic
1200584873 Y:4996411-4996433 CAGAGCCAAGACTCCAAATTTGG + Intergenic
1201364671 Y:13190467-13190489 AAGAGACACTTCTCAAAAGAAGG - Intergenic
1202056561 Y:20839285-20839307 CAGAGCCACCAGGCTAAAGAAGG - Intergenic