ID: 1155307584

View in Genome Browser
Species Human (GRCh38)
Location 18:24493733-24493755
Sequence AACCTGGTTGGTGGTCATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155307584_1155307589 9 Left 1155307584 18:24493733-24493755 CCTATATGACCACCAACCAGGTT No data
Right 1155307589 18:24493765-24493787 AATATTTTTATTGCCCCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155307584 Original CRISPR AACCTGGTTGGTGGTCATAT AGG (reversed) Intergenic
No off target data available for this crispr