ID: 1155311307

View in Genome Browser
Species Human (GRCh38)
Location 18:24526630-24526652
Sequence AAGAAACCCATTGATATTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155311307_1155311309 2 Left 1155311307 18:24526630-24526652 CCATTAATATCAATGGGTTTCTT No data
Right 1155311309 18:24526655-24526677 TATTTTTGGAATAATCCCAATGG No data
1155311307_1155311310 7 Left 1155311307 18:24526630-24526652 CCATTAATATCAATGGGTTTCTT No data
Right 1155311310 18:24526660-24526682 TTGGAATAATCCCAATGGTATGG No data
1155311307_1155311311 8 Left 1155311307 18:24526630-24526652 CCATTAATATCAATGGGTTTCTT No data
Right 1155311311 18:24526661-24526683 TGGAATAATCCCAATGGTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155311307 Original CRISPR AAGAAACCCATTGATATTAA TGG (reversed) Intergenic
No off target data available for this crispr