ID: 1155311311

View in Genome Browser
Species Human (GRCh38)
Location 18:24526661-24526683
Sequence TGGAATAATCCCAATGGTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155311307_1155311311 8 Left 1155311307 18:24526630-24526652 CCATTAATATCAATGGGTTTCTT No data
Right 1155311311 18:24526661-24526683 TGGAATAATCCCAATGGTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155311311 Original CRISPR TGGAATAATCCCAATGGTAT GGG Intergenic
No off target data available for this crispr