ID: 1155311985

View in Genome Browser
Species Human (GRCh38)
Location 18:24532930-24532952
Sequence GCTGCTTGTCCTCCCCACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155311985_1155311991 22 Left 1155311985 18:24532930-24532952 CCAGGGTGGGGAGGACAAGCAGC No data
Right 1155311991 18:24532975-24532997 GAGCGAATCCACTGGCCTGCAGG No data
1155311985_1155311987 -10 Left 1155311985 18:24532930-24532952 CCAGGGTGGGGAGGACAAGCAGC No data
Right 1155311987 18:24532943-24532965 GACAAGCAGCAGTCTAATTCGGG No data
1155311985_1155311988 -9 Left 1155311985 18:24532930-24532952 CCAGGGTGGGGAGGACAAGCAGC No data
Right 1155311988 18:24532944-24532966 ACAAGCAGCAGTCTAATTCGGGG No data
1155311985_1155311989 14 Left 1155311985 18:24532930-24532952 CCAGGGTGGGGAGGACAAGCAGC No data
Right 1155311989 18:24532967-24532989 CTCAACCTGAGCGAATCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155311985 Original CRISPR GCTGCTTGTCCTCCCCACCC TGG (reversed) Intergenic
No off target data available for this crispr