ID: 1155312397

View in Genome Browser
Species Human (GRCh38)
Location 18:24536646-24536668
Sequence TGTTGAGGTCCCTCCTTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155312393_1155312397 21 Left 1155312393 18:24536602-24536624 CCCTTGATAAAGGTTAGGAAGAT No data
Right 1155312397 18:24536646-24536668 TGTTGAGGTCCCTCCTTAGGAGG No data
1155312394_1155312397 20 Left 1155312394 18:24536603-24536625 CCTTGATAAAGGTTAGGAAGATG No data
Right 1155312397 18:24536646-24536668 TGTTGAGGTCCCTCCTTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155312397 Original CRISPR TGTTGAGGTCCCTCCTTAGG AGG Intergenic
No off target data available for this crispr