ID: 1155317012

View in Genome Browser
Species Human (GRCh38)
Location 18:24582065-24582087
Sequence CAACTCGGTGAATCCAGAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155317012_1155317016 -9 Left 1155317012 18:24582065-24582087 CCAATTCTGGATTCACCGAGTTG No data
Right 1155317016 18:24582079-24582101 ACCGAGTTGGGGATGCCTGTAGG No data
1155317012_1155317018 3 Left 1155317012 18:24582065-24582087 CCAATTCTGGATTCACCGAGTTG No data
Right 1155317018 18:24582091-24582113 ATGCCTGTAGGATGTTCAAGTGG No data
1155317012_1155317024 17 Left 1155317012 18:24582065-24582087 CCAATTCTGGATTCACCGAGTTG No data
Right 1155317024 18:24582105-24582127 TTCAAGTGGAGGGGCCATGAGGG No data
1155317012_1155317023 16 Left 1155317012 18:24582065-24582087 CCAATTCTGGATTCACCGAGTTG No data
Right 1155317023 18:24582104-24582126 GTTCAAGTGGAGGGGCCATGAGG No data
1155317012_1155317021 7 Left 1155317012 18:24582065-24582087 CCAATTCTGGATTCACCGAGTTG No data
Right 1155317021 18:24582095-24582117 CTGTAGGATGTTCAAGTGGAGGG No data
1155317012_1155317020 6 Left 1155317012 18:24582065-24582087 CCAATTCTGGATTCACCGAGTTG No data
Right 1155317020 18:24582094-24582116 CCTGTAGGATGTTCAAGTGGAGG No data
1155317012_1155317022 8 Left 1155317012 18:24582065-24582087 CCAATTCTGGATTCACCGAGTTG No data
Right 1155317022 18:24582096-24582118 TGTAGGATGTTCAAGTGGAGGGG No data
1155317012_1155317025 18 Left 1155317012 18:24582065-24582087 CCAATTCTGGATTCACCGAGTTG No data
Right 1155317025 18:24582106-24582128 TCAAGTGGAGGGGCCATGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155317012 Original CRISPR CAACTCGGTGAATCCAGAAT TGG (reversed) Intergenic
No off target data available for this crispr