ID: 1155317017

View in Genome Browser
Species Human (GRCh38)
Location 18:24582080-24582102
Sequence TCCTACAGGCATCCCCAACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155317017_1155317029 24 Left 1155317017 18:24582080-24582102 CCGAGTTGGGGATGCCTGTAGGA No data
Right 1155317029 18:24582127-24582149 GGCCTGAGAGAAGTTAGGGCAGG No data
1155317017_1155317022 -7 Left 1155317017 18:24582080-24582102 CCGAGTTGGGGATGCCTGTAGGA No data
Right 1155317022 18:24582096-24582118 TGTAGGATGTTCAAGTGGAGGGG No data
1155317017_1155317024 2 Left 1155317017 18:24582080-24582102 CCGAGTTGGGGATGCCTGTAGGA No data
Right 1155317024 18:24582105-24582127 TTCAAGTGGAGGGGCCATGAGGG No data
1155317017_1155317028 20 Left 1155317017 18:24582080-24582102 CCGAGTTGGGGATGCCTGTAGGA No data
Right 1155317028 18:24582123-24582145 GAGGGGCCTGAGAGAAGTTAGGG No data
1155317017_1155317027 19 Left 1155317017 18:24582080-24582102 CCGAGTTGGGGATGCCTGTAGGA No data
Right 1155317027 18:24582122-24582144 TGAGGGGCCTGAGAGAAGTTAGG No data
1155317017_1155317020 -9 Left 1155317017 18:24582080-24582102 CCGAGTTGGGGATGCCTGTAGGA No data
Right 1155317020 18:24582094-24582116 CCTGTAGGATGTTCAAGTGGAGG No data
1155317017_1155317021 -8 Left 1155317017 18:24582080-24582102 CCGAGTTGGGGATGCCTGTAGGA No data
Right 1155317021 18:24582095-24582117 CTGTAGGATGTTCAAGTGGAGGG No data
1155317017_1155317023 1 Left 1155317017 18:24582080-24582102 CCGAGTTGGGGATGCCTGTAGGA No data
Right 1155317023 18:24582104-24582126 GTTCAAGTGGAGGGGCCATGAGG No data
1155317017_1155317025 3 Left 1155317017 18:24582080-24582102 CCGAGTTGGGGATGCCTGTAGGA No data
Right 1155317025 18:24582106-24582128 TCAAGTGGAGGGGCCATGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155317017 Original CRISPR TCCTACAGGCATCCCCAACT CGG (reversed) Intergenic
No off target data available for this crispr