ID: 1155317022

View in Genome Browser
Species Human (GRCh38)
Location 18:24582096-24582118
Sequence TGTAGGATGTTCAAGTGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155317017_1155317022 -7 Left 1155317017 18:24582080-24582102 CCGAGTTGGGGATGCCTGTAGGA No data
Right 1155317022 18:24582096-24582118 TGTAGGATGTTCAAGTGGAGGGG No data
1155317012_1155317022 8 Left 1155317012 18:24582065-24582087 CCAATTCTGGATTCACCGAGTTG No data
Right 1155317022 18:24582096-24582118 TGTAGGATGTTCAAGTGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155317022 Original CRISPR TGTAGGATGTTCAAGTGGAG GGG Intergenic
No off target data available for this crispr