ID: 1155319082

View in Genome Browser
Species Human (GRCh38)
Location 18:24601192-24601214
Sequence GTGGCCAAATGTACTGAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155319082_1155319085 19 Left 1155319082 18:24601192-24601214 CCAATCTCAGTACATTTGGCCAC No data
Right 1155319085 18:24601234-24601256 TTTAGACTTGCAGTAATATTAGG No data
1155319082_1155319086 29 Left 1155319082 18:24601192-24601214 CCAATCTCAGTACATTTGGCCAC No data
Right 1155319086 18:24601244-24601266 CAGTAATATTAGGCAAAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155319082 Original CRISPR GTGGCCAAATGTACTGAGAT TGG (reversed) Intergenic
No off target data available for this crispr