ID: 1155324120

View in Genome Browser
Species Human (GRCh38)
Location 18:24648990-24649012
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155324120_1155324123 3 Left 1155324120 18:24648990-24649012 CCCATATGAATGTGAACTGCTTT No data
Right 1155324123 18:24649016-24649038 ATTCTTCTTTCAGATGGAAAAGG No data
1155324120_1155324122 -3 Left 1155324120 18:24648990-24649012 CCCATATGAATGTGAACTGCTTT No data
Right 1155324122 18:24649010-24649032 TTTCTGATTCTTCTTTCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155324120 Original CRISPR AAAGCAGTTCACATTCATAT GGG (reversed) Intergenic
No off target data available for this crispr