ID: 1155324122

View in Genome Browser
Species Human (GRCh38)
Location 18:24649010-24649032
Sequence TTTCTGATTCTTCTTTCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155324118_1155324122 21 Left 1155324118 18:24648966-24648988 CCATAATAGTGTATTGTTAACCA No data
Right 1155324122 18:24649010-24649032 TTTCTGATTCTTCTTTCAGATGG No data
1155324121_1155324122 -4 Left 1155324121 18:24648991-24649013 CCATATGAATGTGAACTGCTTTC No data
Right 1155324122 18:24649010-24649032 TTTCTGATTCTTCTTTCAGATGG No data
1155324120_1155324122 -3 Left 1155324120 18:24648990-24649012 CCCATATGAATGTGAACTGCTTT No data
Right 1155324122 18:24649010-24649032 TTTCTGATTCTTCTTTCAGATGG No data
1155324119_1155324122 1 Left 1155324119 18:24648986-24649008 CCATCCCATATGAATGTGAACTG No data
Right 1155324122 18:24649010-24649032 TTTCTGATTCTTCTTTCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155324122 Original CRISPR TTTCTGATTCTTCTTTCAGA TGG Intergenic
No off target data available for this crispr