ID: 1155324174

View in Genome Browser
Species Human (GRCh38)
Location 18:24649552-24649574
Sequence GAGCCAAGTGTTCAATTTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155324171_1155324174 -6 Left 1155324171 18:24649535-24649557 CCCACACTAACCTGTAAGAGCCA No data
Right 1155324174 18:24649552-24649574 GAGCCAAGTGTTCAATTTTTAGG No data
1155324172_1155324174 -7 Left 1155324172 18:24649536-24649558 CCACACTAACCTGTAAGAGCCAA No data
Right 1155324174 18:24649552-24649574 GAGCCAAGTGTTCAATTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155324174 Original CRISPR GAGCCAAGTGTTCAATTTTT AGG Intergenic
No off target data available for this crispr