ID: 1155334125

View in Genome Browser
Species Human (GRCh38)
Location 18:24747824-24747846
Sequence TTCTATGGGACTTGAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155334125_1155334132 0 Left 1155334125 18:24747824-24747846 CCTTCCTCTCAAGTCCCATAGAA No data
Right 1155334132 18:24747847-24747869 ATGATGGGGATTGCCCCAGATGG No data
1155334125_1155334133 12 Left 1155334125 18:24747824-24747846 CCTTCCTCTCAAGTCCCATAGAA No data
Right 1155334133 18:24747859-24747881 GCCCCAGATGGATATGCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155334125 Original CRISPR TTCTATGGGACTTGAGAGGA AGG (reversed) Intergenic
No off target data available for this crispr