ID: 1155337855

View in Genome Browser
Species Human (GRCh38)
Location 18:24783713-24783735
Sequence GAGGCAGCCTGCCATGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155337855_1155337858 -4 Left 1155337855 18:24783713-24783735 CCTTCCACATGGCAGGCTGCCTC No data
Right 1155337858 18:24783732-24783754 CCTCCTCTGTCTTTACTCATAGG No data
1155337855_1155337862 18 Left 1155337855 18:24783713-24783735 CCTTCCACATGGCAGGCTGCCTC No data
Right 1155337862 18:24783754-24783776 GTCCAGTTTTGACAGGGACCAGG No data
1155337855_1155337860 11 Left 1155337855 18:24783713-24783735 CCTTCCACATGGCAGGCTGCCTC No data
Right 1155337860 18:24783747-24783769 CTCATAGGTCCAGTTTTGACAGG No data
1155337855_1155337861 12 Left 1155337855 18:24783713-24783735 CCTTCCACATGGCAGGCTGCCTC No data
Right 1155337861 18:24783748-24783770 TCATAGGTCCAGTTTTGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155337855 Original CRISPR GAGGCAGCCTGCCATGTGGA AGG (reversed) Intergenic
No off target data available for this crispr