ID: 1155347878

View in Genome Browser
Species Human (GRCh38)
Location 18:24876463-24876485
Sequence TCTTGTCCTCCAGGGCCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155347878_1155347883 -7 Left 1155347878 18:24876463-24876485 CCCAGTGGCCCTGGAGGACAAGA No data
Right 1155347883 18:24876479-24876501 GACAAGAAGTCTGTGGCCACAGG No data
1155347878_1155347884 -3 Left 1155347878 18:24876463-24876485 CCCAGTGGCCCTGGAGGACAAGA No data
Right 1155347884 18:24876483-24876505 AGAAGTCTGTGGCCACAGGAAGG No data
1155347878_1155347885 0 Left 1155347878 18:24876463-24876485 CCCAGTGGCCCTGGAGGACAAGA No data
Right 1155347885 18:24876486-24876508 AGTCTGTGGCCACAGGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155347878 Original CRISPR TCTTGTCCTCCAGGGCCACT GGG (reversed) Intergenic