ID: 1155347966

View in Genome Browser
Species Human (GRCh38)
Location 18:24877396-24877418
Sequence GGGCATTGCCTTACAAACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155347966_1155347973 18 Left 1155347966 18:24877396-24877418 CCTTTGTTTGTAAGGCAATGCCC No data
Right 1155347973 18:24877437-24877459 CCCCAAAGCTAAGGTATGTGCGG No data
1155347966_1155347967 -6 Left 1155347966 18:24877396-24877418 CCTTTGTTTGTAAGGCAATGCCC No data
Right 1155347967 18:24877413-24877435 ATGCCCATCTTTTGTCATTCAGG No data
1155347966_1155347970 9 Left 1155347966 18:24877396-24877418 CCTTTGTTTGTAAGGCAATGCCC No data
Right 1155347970 18:24877428-24877450 CATTCAGGCCCCCAAAGCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155347966 Original CRISPR GGGCATTGCCTTACAAACAA AGG (reversed) Intergenic
No off target data available for this crispr