ID: 1155349380

View in Genome Browser
Species Human (GRCh38)
Location 18:24891650-24891672
Sequence GAAATATAGGAGCCCTCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155349380_1155349390 30 Left 1155349380 18:24891650-24891672 CCCTGTGAGGGCTCCTATATTTC No data
Right 1155349390 18:24891703-24891725 TGGGGTCCCAACTAATATCCTGG No data
1155349380_1155349389 12 Left 1155349380 18:24891650-24891672 CCCTGTGAGGGCTCCTATATTTC No data
Right 1155349389 18:24891685-24891707 CCTTCTTTGGTGTGGTCTTGGGG No data
1155349380_1155349386 10 Left 1155349380 18:24891650-24891672 CCCTGTGAGGGCTCCTATATTTC No data
Right 1155349386 18:24891683-24891705 TTCCTTCTTTGGTGTGGTCTTGG No data
1155349380_1155349385 4 Left 1155349380 18:24891650-24891672 CCCTGTGAGGGCTCCTATATTTC No data
Right 1155349385 18:24891677-24891699 TCACTTTTCCTTCTTTGGTGTGG No data
1155349380_1155349384 -1 Left 1155349380 18:24891650-24891672 CCCTGTGAGGGCTCCTATATTTC No data
Right 1155349384 18:24891672-24891694 CCAGTTCACTTTTCCTTCTTTGG No data
1155349380_1155349387 11 Left 1155349380 18:24891650-24891672 CCCTGTGAGGGCTCCTATATTTC No data
Right 1155349387 18:24891684-24891706 TCCTTCTTTGGTGTGGTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155349380 Original CRISPR GAAATATAGGAGCCCTCACA GGG (reversed) Intergenic
No off target data available for this crispr