ID: 1155349382

View in Genome Browser
Species Human (GRCh38)
Location 18:24891663-24891685
Sequence GAAAAGTGAACTGGAAATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155349382_1155349395 30 Left 1155349382 18:24891663-24891685 CCTATATTTCCAGTTCACTTTTC No data
Right 1155349395 18:24891716-24891738 AATATCCTGGGGTGTTTTCCAGG No data
1155349382_1155349385 -9 Left 1155349382 18:24891663-24891685 CCTATATTTCCAGTTCACTTTTC No data
Right 1155349385 18:24891677-24891699 TCACTTTTCCTTCTTTGGTGTGG No data
1155349382_1155349389 -1 Left 1155349382 18:24891663-24891685 CCTATATTTCCAGTTCACTTTTC No data
Right 1155349389 18:24891685-24891707 CCTTCTTTGGTGTGGTCTTGGGG No data
1155349382_1155349386 -3 Left 1155349382 18:24891663-24891685 CCTATATTTCCAGTTCACTTTTC No data
Right 1155349386 18:24891683-24891705 TTCCTTCTTTGGTGTGGTCTTGG No data
1155349382_1155349390 17 Left 1155349382 18:24891663-24891685 CCTATATTTCCAGTTCACTTTTC No data
Right 1155349390 18:24891703-24891725 TGGGGTCCCAACTAATATCCTGG No data
1155349382_1155349391 18 Left 1155349382 18:24891663-24891685 CCTATATTTCCAGTTCACTTTTC No data
Right 1155349391 18:24891704-24891726 GGGGTCCCAACTAATATCCTGGG No data
1155349382_1155349392 19 Left 1155349382 18:24891663-24891685 CCTATATTTCCAGTTCACTTTTC No data
Right 1155349392 18:24891705-24891727 GGGTCCCAACTAATATCCTGGGG No data
1155349382_1155349387 -2 Left 1155349382 18:24891663-24891685 CCTATATTTCCAGTTCACTTTTC No data
Right 1155349387 18:24891684-24891706 TCCTTCTTTGGTGTGGTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155349382 Original CRISPR GAAAAGTGAACTGGAAATAT AGG (reversed) Intergenic
No off target data available for this crispr