ID: 1155349383

View in Genome Browser
Species Human (GRCh38)
Location 18:24891672-24891694
Sequence CCAAAGAAGGAAAAGTGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155349383_1155349391 9 Left 1155349383 18:24891672-24891694 CCAGTTCACTTTTCCTTCTTTGG No data
Right 1155349391 18:24891704-24891726 GGGGTCCCAACTAATATCCTGGG No data
1155349383_1155349390 8 Left 1155349383 18:24891672-24891694 CCAGTTCACTTTTCCTTCTTTGG No data
Right 1155349390 18:24891703-24891725 TGGGGTCCCAACTAATATCCTGG No data
1155349383_1155349389 -10 Left 1155349383 18:24891672-24891694 CCAGTTCACTTTTCCTTCTTTGG No data
Right 1155349389 18:24891685-24891707 CCTTCTTTGGTGTGGTCTTGGGG No data
1155349383_1155349395 21 Left 1155349383 18:24891672-24891694 CCAGTTCACTTTTCCTTCTTTGG No data
Right 1155349395 18:24891716-24891738 AATATCCTGGGGTGTTTTCCAGG No data
1155349383_1155349392 10 Left 1155349383 18:24891672-24891694 CCAGTTCACTTTTCCTTCTTTGG No data
Right 1155349392 18:24891705-24891727 GGGTCCCAACTAATATCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155349383 Original CRISPR CCAAAGAAGGAAAAGTGAAC TGG (reversed) Intergenic
No off target data available for this crispr