ID: 1155349388

View in Genome Browser
Species Human (GRCh38)
Location 18:24891685-24891707
Sequence CCCCAAGACCACACCAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155349388_1155349395 8 Left 1155349388 18:24891685-24891707 CCTTCTTTGGTGTGGTCTTGGGG No data
Right 1155349395 18:24891716-24891738 AATATCCTGGGGTGTTTTCCAGG No data
1155349388_1155349392 -3 Left 1155349388 18:24891685-24891707 CCTTCTTTGGTGTGGTCTTGGGG No data
Right 1155349392 18:24891705-24891727 GGGTCCCAACTAATATCCTGGGG No data
1155349388_1155349390 -5 Left 1155349388 18:24891685-24891707 CCTTCTTTGGTGTGGTCTTGGGG No data
Right 1155349390 18:24891703-24891725 TGGGGTCCCAACTAATATCCTGG No data
1155349388_1155349391 -4 Left 1155349388 18:24891685-24891707 CCTTCTTTGGTGTGGTCTTGGGG No data
Right 1155349391 18:24891704-24891726 GGGGTCCCAACTAATATCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155349388 Original CRISPR CCCCAAGACCACACCAAAGA AGG (reversed) Intergenic
No off target data available for this crispr