ID: 1155349390

View in Genome Browser
Species Human (GRCh38)
Location 18:24891703-24891725
Sequence TGGGGTCCCAACTAATATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155349381_1155349390 29 Left 1155349381 18:24891651-24891673 CCTGTGAGGGCTCCTATATTTCC No data
Right 1155349390 18:24891703-24891725 TGGGGTCCCAACTAATATCCTGG No data
1155349380_1155349390 30 Left 1155349380 18:24891650-24891672 CCCTGTGAGGGCTCCTATATTTC No data
Right 1155349390 18:24891703-24891725 TGGGGTCCCAACTAATATCCTGG No data
1155349383_1155349390 8 Left 1155349383 18:24891672-24891694 CCAGTTCACTTTTCCTTCTTTGG No data
Right 1155349390 18:24891703-24891725 TGGGGTCCCAACTAATATCCTGG No data
1155349382_1155349390 17 Left 1155349382 18:24891663-24891685 CCTATATTTCCAGTTCACTTTTC No data
Right 1155349390 18:24891703-24891725 TGGGGTCCCAACTAATATCCTGG No data
1155349388_1155349390 -5 Left 1155349388 18:24891685-24891707 CCTTCTTTGGTGTGGTCTTGGGG No data
Right 1155349390 18:24891703-24891725 TGGGGTCCCAACTAATATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155349390 Original CRISPR TGGGGTCCCAACTAATATCC TGG Intergenic
No off target data available for this crispr