ID: 1155351316

View in Genome Browser
Species Human (GRCh38)
Location 18:24910123-24910145
Sequence TGTTAGTGAGTTATCTGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155351316_1155351319 7 Left 1155351316 18:24910123-24910145 CCATCCCAGATAACTCACTAACA No data
Right 1155351319 18:24910153-24910175 CTTGATGACATGACTCTACATGG No data
1155351316_1155351320 15 Left 1155351316 18:24910123-24910145 CCATCCCAGATAACTCACTAACA No data
Right 1155351320 18:24910161-24910183 CATGACTCTACATGGTAAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155351316 Original CRISPR TGTTAGTGAGTTATCTGGGA TGG (reversed) Intergenic
No off target data available for this crispr