ID: 1155354445

View in Genome Browser
Species Human (GRCh38)
Location 18:24937773-24937795
Sequence AGTTTTATAACAGTGACTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155354445_1155354446 -10 Left 1155354445 18:24937773-24937795 CCAGGAGTCACTGTTATAAAACT No data
Right 1155354446 18:24937786-24937808 TTATAAAACTCCCCTTCATCTGG No data
1155354445_1155354447 -4 Left 1155354445 18:24937773-24937795 CCAGGAGTCACTGTTATAAAACT No data
Right 1155354447 18:24937792-24937814 AACTCCCCTTCATCTGGCATTGG No data
1155354445_1155354454 30 Left 1155354445 18:24937773-24937795 CCAGGAGTCACTGTTATAAAACT No data
Right 1155354454 18:24937826-24937848 GTCAGCTGACTCAGCCAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155354445 Original CRISPR AGTTTTATAACAGTGACTCC TGG (reversed) Intergenic
No off target data available for this crispr