ID: 1155354448 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 18:24937796-24937818 |
| Sequence | TTGGCCAATGCCAGATGAAG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1155354448_1155354457 | 28 | Left | 1155354448 | 18:24937796-24937818 | CCCCTTCATCTGGCATTGGCCAA | No data | ||
| Right | 1155354457 | 18:24937847-24937869 | GGTTTGCACATCGTGAAAGCGGG | No data | ||||
| 1155354448_1155354454 | 7 | Left | 1155354448 | 18:24937796-24937818 | CCCCTTCATCTGGCATTGGCCAA | No data | ||
| Right | 1155354454 | 18:24937826-24937848 | GTCAGCTGACTCAGCCAAGAAGG | No data | ||||
| 1155354448_1155354456 | 27 | Left | 1155354448 | 18:24937796-24937818 | CCCCTTCATCTGGCATTGGCCAA | No data | ||
| Right | 1155354456 | 18:24937846-24937868 | AGGTTTGCACATCGTGAAAGCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1155354448 | Original CRISPR | TTGGCCAATGCCAGATGAAG GGG (reversed) | Intergenic | ||