ID: 1155354448

View in Genome Browser
Species Human (GRCh38)
Location 18:24937796-24937818
Sequence TTGGCCAATGCCAGATGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155354448_1155354457 28 Left 1155354448 18:24937796-24937818 CCCCTTCATCTGGCATTGGCCAA No data
Right 1155354457 18:24937847-24937869 GGTTTGCACATCGTGAAAGCGGG No data
1155354448_1155354454 7 Left 1155354448 18:24937796-24937818 CCCCTTCATCTGGCATTGGCCAA No data
Right 1155354454 18:24937826-24937848 GTCAGCTGACTCAGCCAAGAAGG No data
1155354448_1155354456 27 Left 1155354448 18:24937796-24937818 CCCCTTCATCTGGCATTGGCCAA No data
Right 1155354456 18:24937846-24937868 AGGTTTGCACATCGTGAAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155354448 Original CRISPR TTGGCCAATGCCAGATGAAG GGG (reversed) Intergenic
No off target data available for this crispr