ID: 1155354450

View in Genome Browser
Species Human (GRCh38)
Location 18:24937798-24937820
Sequence TTTTGGCCAATGCCAGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155354450_1155354456 25 Left 1155354450 18:24937798-24937820 CCTTCATCTGGCATTGGCCAAAA No data
Right 1155354456 18:24937846-24937868 AGGTTTGCACATCGTGAAAGCGG No data
1155354450_1155354457 26 Left 1155354450 18:24937798-24937820 CCTTCATCTGGCATTGGCCAAAA No data
Right 1155354457 18:24937847-24937869 GGTTTGCACATCGTGAAAGCGGG No data
1155354450_1155354454 5 Left 1155354450 18:24937798-24937820 CCTTCATCTGGCATTGGCCAAAA No data
Right 1155354454 18:24937826-24937848 GTCAGCTGACTCAGCCAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155354450 Original CRISPR TTTTGGCCAATGCCAGATGA AGG (reversed) Intergenic
No off target data available for this crispr