ID: 1155354451 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 18:24937815-24937837 |
| Sequence | GAGTCAGCTGACAGGGCTTT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1155354451_1155354456 | 8 | Left | 1155354451 | 18:24937815-24937837 | CCAAAAGCCCTGTCAGCTGACTC | No data | ||
| Right | 1155354456 | 18:24937846-24937868 | AGGTTTGCACATCGTGAAAGCGG | No data | ||||
| 1155354451_1155354457 | 9 | Left | 1155354451 | 18:24937815-24937837 | CCAAAAGCCCTGTCAGCTGACTC | No data | ||
| Right | 1155354457 | 18:24937847-24937869 | GGTTTGCACATCGTGAAAGCGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1155354451 | Original CRISPR | GAGTCAGCTGACAGGGCTTT TGG (reversed) | Intergenic | ||