ID: 1155354454

View in Genome Browser
Species Human (GRCh38)
Location 18:24937826-24937848
Sequence GTCAGCTGACTCAGCCAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155354450_1155354454 5 Left 1155354450 18:24937798-24937820 CCTTCATCTGGCATTGGCCAAAA No data
Right 1155354454 18:24937826-24937848 GTCAGCTGACTCAGCCAAGAAGG No data
1155354445_1155354454 30 Left 1155354445 18:24937773-24937795 CCAGGAGTCACTGTTATAAAACT No data
Right 1155354454 18:24937826-24937848 GTCAGCTGACTCAGCCAAGAAGG No data
1155354449_1155354454 6 Left 1155354449 18:24937797-24937819 CCCTTCATCTGGCATTGGCCAAA No data
Right 1155354454 18:24937826-24937848 GTCAGCTGACTCAGCCAAGAAGG No data
1155354448_1155354454 7 Left 1155354448 18:24937796-24937818 CCCCTTCATCTGGCATTGGCCAA No data
Right 1155354454 18:24937826-24937848 GTCAGCTGACTCAGCCAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155354454 Original CRISPR GTCAGCTGACTCAGCCAAGA AGG Intergenic
No off target data available for this crispr