ID: 1155354457

View in Genome Browser
Species Human (GRCh38)
Location 18:24937847-24937869
Sequence GGTTTGCACATCGTGAAAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155354450_1155354457 26 Left 1155354450 18:24937798-24937820 CCTTCATCTGGCATTGGCCAAAA No data
Right 1155354457 18:24937847-24937869 GGTTTGCACATCGTGAAAGCGGG No data
1155354449_1155354457 27 Left 1155354449 18:24937797-24937819 CCCTTCATCTGGCATTGGCCAAA No data
Right 1155354457 18:24937847-24937869 GGTTTGCACATCGTGAAAGCGGG No data
1155354451_1155354457 9 Left 1155354451 18:24937815-24937837 CCAAAAGCCCTGTCAGCTGACTC No data
Right 1155354457 18:24937847-24937869 GGTTTGCACATCGTGAAAGCGGG No data
1155354453_1155354457 1 Left 1155354453 18:24937823-24937845 CCTGTCAGCTGACTCAGCCAAGA No data
Right 1155354457 18:24937847-24937869 GGTTTGCACATCGTGAAAGCGGG No data
1155354452_1155354457 2 Left 1155354452 18:24937822-24937844 CCCTGTCAGCTGACTCAGCCAAG No data
Right 1155354457 18:24937847-24937869 GGTTTGCACATCGTGAAAGCGGG No data
1155354448_1155354457 28 Left 1155354448 18:24937796-24937818 CCCCTTCATCTGGCATTGGCCAA No data
Right 1155354457 18:24937847-24937869 GGTTTGCACATCGTGAAAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155354457 Original CRISPR GGTTTGCACATCGTGAAAGC GGG Intergenic
No off target data available for this crispr