ID: 1155356237

View in Genome Browser
Species Human (GRCh38)
Location 18:24956808-24956830
Sequence TTTGGCCCACTCTAAATTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155356234_1155356237 -1 Left 1155356234 18:24956786-24956808 CCTTAAATCAGATAGTATCTACT No data
Right 1155356237 18:24956808-24956830 TTTGGCCCACTCTAAATTTAGGG No data
1155356229_1155356237 29 Left 1155356229 18:24956756-24956778 CCATAGAATGACCCTGGAGATAA No data
Right 1155356237 18:24956808-24956830 TTTGGCCCACTCTAAATTTAGGG No data
1155356232_1155356237 18 Left 1155356232 18:24956767-24956789 CCCTGGAGATAAAGGGCTGCCTT No data
Right 1155356237 18:24956808-24956830 TTTGGCCCACTCTAAATTTAGGG No data
1155356233_1155356237 17 Left 1155356233 18:24956768-24956790 CCTGGAGATAAAGGGCTGCCTTA No data
Right 1155356237 18:24956808-24956830 TTTGGCCCACTCTAAATTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155356237 Original CRISPR TTTGGCCCACTCTAAATTTA GGG Intergenic
No off target data available for this crispr