ID: 1155363509

View in Genome Browser
Species Human (GRCh38)
Location 18:25027832-25027854
Sequence TAGGGAAAACAAAAGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155363504_1155363509 19 Left 1155363504 18:25027790-25027812 CCAAACTGTGTGTGTTCACTTCT No data
Right 1155363509 18:25027832-25027854 TAGGGAAAACAAAAGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155363509 Original CRISPR TAGGGAAAACAAAAGGAAGA AGG Intergenic
No off target data available for this crispr