ID: 1155367124

View in Genome Browser
Species Human (GRCh38)
Location 18:25059679-25059701
Sequence GAGCCCGATGCCCAGTCGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155367121_1155367124 24 Left 1155367121 18:25059632-25059654 CCTCTTGGCTTTGTATGGAAAGA No data
Right 1155367124 18:25059679-25059701 GAGCCCGATGCCCAGTCGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155367124 Original CRISPR GAGCCCGATGCCCAGTCGTG TGG Intergenic
No off target data available for this crispr