ID: 1155368203

View in Genome Browser
Species Human (GRCh38)
Location 18:25070562-25070584
Sequence GGGGCTTGCCTTACACAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 81}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155368196_1155368203 15 Left 1155368196 18:25070524-25070546 CCAGAGAGGAGCCTGAAAATAGA 0: 1
1: 0
2: 1
3: 19
4: 202
Right 1155368203 18:25070562-25070584 GGGGCTTGCCTTACACAAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 81
1155368198_1155368203 4 Left 1155368198 18:25070535-25070557 CCTGAAAATAGATTTTAGAAGGC 0: 1
1: 0
2: 2
3: 24
4: 282
Right 1155368203 18:25070562-25070584 GGGGCTTGCCTTACACAAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155368203 Original CRISPR GGGGCTTGCCTTACACAAGC AGG Intronic
908257902 1:62318070-62318092 TGGGCTTGATTTACCCAAGCAGG + Intronic
909910621 1:81253746-81253768 AAGGCTTGCCTTAGACAAGTAGG + Intergenic
910790941 1:91049751-91049773 GGGTCTTGCCTCACCTAAGCTGG + Intergenic
913509272 1:119547597-119547619 TGGGCATGCCTTACAAGAGCTGG - Intergenic
915488950 1:156241058-156241080 GGGGCAGGCCTGACAGAAGCAGG - Intronic
918968629 1:191383020-191383042 GGGGCTTCCAGTTCACAAGCAGG - Intergenic
924668158 1:246094938-246094960 GGGGCTTGCCGTAAACACTCAGG - Intronic
1065598935 10:27348747-27348769 GGGGCTTGTATTACACAGGAAGG - Intergenic
1069549005 10:69349503-69349525 GGGGCTCGGCTTACACATTCAGG - Intronic
1070992394 10:80743985-80744007 GGGACTTGTCTTTCACAAGTCGG + Intergenic
1074058623 10:109944271-109944293 GGGGCTTGCCCTGCACCTGCTGG + Intronic
1077197746 11:1289713-1289735 GGGTCTTGCCGCACACCAGCAGG - Intronic
1077605592 11:3609063-3609085 GGGTCTTGCCCTACCCAGGCTGG - Intergenic
1077638401 11:3859394-3859416 GGGGCTTGCGTTTCTGAAGCTGG + Intronic
1078208695 11:9252686-9252708 GAGGCTTGCCTTTCAGAAGCTGG - Intronic
1086379294 11:86235437-86235459 GGGGCTTGCTCTATACAGGCAGG - Intergenic
1089612656 11:119678100-119678122 GCTGCTTGCCTTAGACATGCTGG - Intronic
1089632160 11:119790553-119790575 GGGGCTTGCCTGACACCATTTGG + Intergenic
1093109081 12:15127487-15127509 GGGTCTTGCCTTTCTCAATCAGG - Intronic
1093735571 12:22616257-22616279 AGGCCTTGCCTTACTTAAGCAGG - Intergenic
1096161160 12:49378683-49378705 GGGGATTGCCTGACCCCAGCAGG - Intronic
1104362929 12:128151049-128151071 GGGACTTACCTTCCACCAGCTGG + Intergenic
1108599696 13:51981875-51981897 CAGGCTTGCCTTAGACAAACGGG - Intronic
1114226529 14:20743697-20743719 GGAGCTTCTGTTACACAAGCTGG + Intronic
1120080446 14:80210542-80210564 GAGGCTTCCCTTACAAATGCTGG + Intronic
1123154117 14:106208041-106208063 TGGGCATTCCTTACAGAAGCAGG + Intergenic
1124095585 15:26645796-26645818 GGGTCTTGCCTCACCCAAGCTGG + Intronic
1124187511 15:27542956-27542978 GGGGCTGCACTTACACAAGGGGG + Intergenic
1125347025 15:38728645-38728667 GGGGCCAGCCTTGCACAAGGTGG + Intergenic
1125374979 15:39019209-39019231 AGGGCTTGCTTTACTCAAGGAGG + Intergenic
1125671430 15:41476180-41476202 GTGGCTAGCCTTACACTACCAGG + Intronic
1133915220 16:10103319-10103341 GTGGCTCTCCTTGCACAAGCTGG + Intronic
1135991692 16:27222498-27222520 GGGGTTTGAGTTACACAGGCGGG - Intergenic
1139140693 16:64258904-64258926 GGGGCTTGCCTGAGAGAAGGTGG - Intergenic
1146605097 17:34251186-34251208 GGGGCTTGCATTGTACAAGGTGG - Intergenic
1155368203 18:25070562-25070584 GGGGCTTGCCTTACACAAGCAGG + Intronic
1156392025 18:36659793-36659815 GGGGCTTCCCTTTCAGAACCTGG - Intronic
1164505431 19:28856752-28856774 GGGGCTTCACTAACTCAAGCAGG - Intergenic
1167463446 19:49638296-49638318 GGGCCTTTCTCTACACAAGCAGG + Intronic
925132808 2:1505337-1505359 GGTGTGTGCCTGACACAAGCTGG - Intronic
925871788 2:8278143-8278165 GGGGCTTGCTTTCCGCAATCAGG - Intergenic
935090477 2:99890855-99890877 GGGGCCTGCCTTCCCCAGGCTGG + Intronic
938773658 2:134522247-134522269 GGGGCTTGTTTTCCACAAGAGGG + Intronic
941819144 2:169827573-169827595 GGGGCTGGCCCTAGACAAGGCGG + Exonic
944295167 2:198053387-198053409 TGGGCCTGTCTTACACAAGCTGG - Intronic
945912372 2:215663751-215663773 GGGGCCTGCCTGAGACAAGTGGG + Intergenic
948839503 2:240642132-240642154 GGGCCTTGCCTGGCCCAAGCGGG + Intergenic
1171209066 20:23303015-23303037 GGGGCTTGTGTTGCAGAAGCCGG - Intergenic
1172587853 20:36097290-36097312 GGGGCTTGCCATGTACTAGCTGG + Intronic
1176167398 20:63681296-63681318 GGGGCGTGCCCTCCACAAACCGG - Intronic
1176259544 20:64172273-64172295 TGGGCTTACCCTACCCAAGCAGG + Intronic
1179817157 21:43913973-43913995 TGGGTTTTCCTTACAAAAGCTGG - Intronic
1183062740 22:35345934-35345956 GGGGCGTGCCAAACACAAGGTGG - Intronic
1183074805 22:35420047-35420069 GGGGCTTGCTTTACACAGCAGGG + Intronic
1184903193 22:47460401-47460423 GGGCATTGCCATACACCAGCCGG - Intergenic
1185408371 22:50670593-50670615 GATGGCTGCCTTACACAAGCTGG + Intergenic
950449802 3:13059186-13059208 AGGGCTCTCCTTACACCAGCAGG + Intronic
950962661 3:17121927-17121949 GGGGCTTTCCTTAAAAAATCTGG - Intergenic
952881045 3:37986581-37986603 AGGGCTTTCCTGACCCAAGCTGG + Intergenic
954028926 3:47803950-47803972 AGGGTTTGCCATACACTAGCAGG + Intronic
960386866 3:117030951-117030973 TGGCCTTGCCTTACTTAAGCAGG - Intronic
967813139 3:193777234-193777256 GGGGCTTGCCCTACCCACCCTGG + Intergenic
969358870 4:6648564-6648586 GGGTCTTGCTTTGCCCAAGCTGG + Intergenic
971417890 4:26450422-26450444 TGGGCTTCCCTTGCAAAAGCAGG - Intergenic
973826285 4:54710297-54710319 GGGGCCTCCCTTGCACTAGCAGG - Intronic
986775966 5:11013945-11013967 GGTGCTTTGCTTACACAGGCAGG + Intronic
991228917 5:64307173-64307195 GGGGCTTGTCTTATACTAGATGG - Intronic
995458951 5:112382467-112382489 GGTGCTTGACTCACACATGCAGG - Intronic
998796932 5:145830423-145830445 TGGGCTTGCCTTTCATGAGCTGG - Intronic
1008379572 6:50826102-50826124 GGGGCTAAAGTTACACAAGCAGG + Intronic
1011674759 6:89721626-89721648 GGGTCTTGCCTCACCCAAGCTGG + Intronic
1015825699 6:137309298-137309320 GGGGCTTGCCTGAGTCTAGCCGG + Intergenic
1020468017 7:8503071-8503093 GGTGCTTTGCTTACACCAGCTGG + Intronic
1021758599 7:23880932-23880954 GAGGCTTGCCTTTTAAAAGCAGG - Intergenic
1024159797 7:46662602-46662624 GGGGCTTGCCTGACTCCAGTGGG - Intergenic
1033259611 7:139831388-139831410 GGGCCTTGCCTCATTCAAGCTGG - Intronic
1035859283 8:3010500-3010522 CGGACTTGCCTGAAACAAGCAGG - Intronic
1039895531 8:41714142-41714164 GGGGCGGGCCTTACCCAGGCAGG + Exonic
1040854264 8:51932499-51932521 GGGTCTTGGCATACTCAAGCTGG - Intergenic
1046108288 8:109691862-109691884 AGGGCTTGCGTTGCACAATCTGG + Intergenic
1050480663 9:6084117-6084139 GGGACTTGTCTTTCACAAGTCGG + Intergenic
1053296424 9:36917451-36917473 GGGGATTCCCTTACAAAAACTGG - Intronic
1057824323 9:98360481-98360503 GGGCCTTGCCTTGGACAATCTGG + Intronic
1187526748 X:20061369-20061391 GGGACTTGCCACACACAGGCTGG - Intronic
1189171333 X:38912653-38912675 GGGACCTGCCTTACAAAAGAAGG + Intergenic
1200052588 X:153442871-153442893 TGGGCTGGCCCTACAGAAGCTGG - Intergenic