ID: 1155369299

View in Genome Browser
Species Human (GRCh38)
Location 18:25080999-25081021
Sequence CAGTCTTTCCTTCCTAATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 200}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155369299 Original CRISPR CAGTCTTTCCTTCCTAATGG AGG Intronic
901766485 1:11503002-11503024 AAGTCTTTCTTTCCAAATTGGGG + Intronic
902252378 1:15162681-15162703 CAGAATTTCCTTCCACATGGAGG - Intronic
902684884 1:18069792-18069814 CAGTCTTTCCATGCTTATGAGGG + Intergenic
904677891 1:32209491-32209513 CTGTTTTCCCTTTCTAATGGAGG - Intronic
909320194 1:74275619-74275641 CATTCTTTCCTTCCTATTTTTGG - Intronic
909493720 1:76254343-76254365 CAGTTTTTCCATCCTGATGAAGG - Intronic
910195261 1:84633613-84633635 AATTCTCTCCTTCCTAAGGGTGG + Intronic
912859038 1:113196616-113196638 AGGTCTCTCCTTCCTCATGGTGG - Intergenic
913420927 1:118668123-118668145 CTGTCTTTTATTCCTAATAGTGG - Intergenic
917458225 1:175204126-175204148 CAGTCTCATCTACCTAATGGTGG - Intergenic
917897619 1:179506940-179506962 CCAGCTTTCCTTCCTTATGGGGG + Intronic
918646923 1:186916325-186916347 CATTCTTTCCTTTCTGAAGGTGG + Intronic
918696271 1:187550454-187550476 CAGAGTTTCCTTCCTTCTGGCGG + Intergenic
918933107 1:190882686-190882708 CCCTCTTTCATTCCTAATGTAGG + Intergenic
919972154 1:202588011-202588033 CATTCTTTCCTTCCTTCTGCAGG - Exonic
922417234 1:225432593-225432615 CAGACTTTTCTTCCTTCTGGTGG - Intergenic
1062787240 10:275314-275336 TAGTCTCTGCTTCCTAAGGGGGG - Exonic
1063624859 10:7679474-7679496 CAGATTTTCCTTCATAATGTGGG - Intergenic
1064106237 10:12502914-12502936 CAGTGTTGCCTTCGCAATGGTGG + Intronic
1065294345 10:24260107-24260129 TAATCTTTCCTTCCTAATTTAGG - Intronic
1065353856 10:24820120-24820142 CTTTCTTTCTTTCTTAATGGGGG - Intergenic
1068721992 10:60255875-60255897 CAGACTTTCCTTCCTCACTGGGG + Intronic
1069656035 10:70089440-70089462 CCTTCTTTCCTTTCTAATGGTGG - Intronic
1071087168 10:81876572-81876594 CTTTCTTTCCTTCCTACCGGCGG - Intronic
1074213497 10:111360796-111360818 CAGTCTTTCCTACCCAATGAAGG - Intergenic
1074795631 10:116939763-116939785 CAGCCTTTCCTTCCCAAATGAGG + Intronic
1075859592 10:125662846-125662868 GAGTCTTTCATTCCTGAAGGGGG + Intronic
1077885542 11:6384883-6384905 CACTCTGTCCTTCCTTATGGAGG - Intergenic
1078323977 11:10363573-10363595 CATTCTTTCATTCGTAATGCTGG - Intronic
1079790626 11:24734226-24734248 CAGCCTTTCCTTACTACAGGAGG + Intronic
1080575757 11:33597716-33597738 CCTTCTTTCCTTCCTCAGGGCGG - Intronic
1084736466 11:71108638-71108660 CAGGCTTCCCTGCCTCATGGAGG + Intronic
1086248787 11:84788705-84788727 CAATCTTCCCTTTCTCATGGAGG - Intronic
1086299396 11:85409383-85409405 CAGTTTTTCCTCCCTAAAAGGGG + Intronic
1086545949 11:87967639-87967661 CAGTGTTTCCTTCCAGGTGGAGG + Intergenic
1086640560 11:89150192-89150214 CAGTTTTTCTTTCCTTATTGTGG - Intergenic
1088459964 11:110072361-110072383 CATTGTTTCCTTCTTAATGACGG + Intergenic
1088511555 11:110580680-110580702 ATGTCTTTCCTTCCTCCTGGAGG + Exonic
1088851248 11:113705278-113705300 AAGTCTTTCCTTCCTCCTGCTGG - Intronic
1089406763 11:118203874-118203896 CAGTTTTTCCATCTGAATGGAGG + Intronic
1089864955 11:121623764-121623786 TAGTATTTCGTTCCTAGTGGAGG + Intronic
1091503334 12:1040739-1040761 TAGGCTTTCCTTCCTAATACTGG + Intronic
1093110991 12:15151822-15151844 CAGTCTTTTCCTCCTGATGAAGG + Intronic
1094430584 12:30365502-30365524 CAGTTTTTCATTCCTTTTGGTGG - Intergenic
1094617854 12:32052336-32052358 CAGTCTTTCATTCCTAGTGCAGG + Intergenic
1095356609 12:41282053-41282075 CAGTCTTTGCCTCTTAATTGGGG - Intronic
1096153653 12:49330202-49330224 CAGTGTGTCCCTCTTAATGGAGG + Exonic
1096221678 12:49833351-49833373 CAGTCGGTCCTTCTTATTGGTGG + Intergenic
1097762750 12:63487219-63487241 CAGTCTTTCCCTCTTGCTGGTGG + Intergenic
1097959211 12:65515980-65516002 TAGACTTTACTTCTTAATGGGGG - Intergenic
1099142651 12:78997955-78997977 CAGTCTTTCCTTTTTAAATGTGG - Intronic
1100301922 12:93315382-93315404 CATTCTTTCCTTCCGCCTGGAGG - Intergenic
1101901816 12:108796520-108796542 CAGTCTTTCCTTCCTTTTTAAGG + Intronic
1102184785 12:110939446-110939468 CAGTATTTTCTTCCTACTGAGGG - Intergenic
1102326469 12:111989320-111989342 CATACTTTCCTGCCTAAAGGGGG - Intronic
1104345595 12:127993838-127993860 CAGTCTTTCCTCCCTGCTGCAGG + Intergenic
1106243511 13:27928090-27928112 CAGTCCTTCCTTACTACTCGTGG + Intergenic
1106691893 13:32126464-32126486 CAGTGTTTGCTTGCCAATGGTGG + Intronic
1107483289 13:40803051-40803073 CAGTCCTTCCTGCCCAATGAAGG + Intronic
1112355167 13:98668381-98668403 TAGATTATCCTTCCTAATGGGGG - Intergenic
1113684747 13:112275210-112275232 CAGACTGCCCTCCCTAATGGGGG + Intergenic
1114653932 14:24304689-24304711 CAGTCTTTAGTTCCAAAGGGTGG + Intronic
1115078988 14:29427733-29427755 CAGCTCTTACTTCCTAATGGAGG - Intergenic
1117730426 14:58716495-58716517 CAGTCTTGCTTTCCTAGTGGAGG + Intergenic
1121844693 14:97162619-97162641 CAGTTTGTCCTTCCTAGTGCAGG - Intergenic
1126025300 15:44440553-44440575 CACTTTTTCCTTCCTAATAATGG + Intronic
1126154659 15:45554185-45554207 CACTCATACTTTCCTAATGGAGG - Intergenic
1126571006 15:50150527-50150549 CAATCATTCCTTCCAAATGTGGG - Intronic
1126952437 15:53896466-53896488 CAGTATTTTCTTCTTAATGTTGG + Intergenic
1129763092 15:78143184-78143206 CAGTCCTTCATTCCTCATGACGG - Intronic
1132613573 16:829390-829412 CTGTTTTTCTTTCCTAATGATGG - Intergenic
1133554351 16:6890635-6890657 CAGTCTTTCCTTCCTATCTAGGG + Intronic
1133946084 16:10349733-10349755 TAGTCTTTGCCTCCCAATGGAGG - Intronic
1135470503 16:22725337-22725359 CAGATTTTCCTCCCTAATGTGGG - Intergenic
1137374108 16:47937471-47937493 CAGTGTGTCCTACCTAAGGGTGG - Intergenic
1140388052 16:74560178-74560200 CAGACTGTCCTTCCCAATGTGGG + Intronic
1141128961 16:81421689-81421711 CAGTGTTTCCCTCCGAAGGGTGG + Intergenic
1144511733 17:15882712-15882734 CTGTTTTTCCTTCCTAAAGCTGG - Intergenic
1147805118 17:43125736-43125758 CACTCTTTCCGCCCTAATGGAGG + Intergenic
1147811124 17:43170577-43170599 CACTCTTTCCGCCCTAATGGAGG + Exonic
1148139089 17:45316188-45316210 AAGTGTTTCCTTCCTAGTCGAGG - Intronic
1149173118 17:53836672-53836694 CAGGCTTTTATTTCTAATGGGGG - Intergenic
1150115931 17:62549560-62549582 CAATCTTTCCTTACTAATTAAGG - Intronic
1150585011 17:66509569-66509591 CAGACTGTCCTTCCTAGTGCAGG - Intronic
1150957089 17:69870947-69870969 CAGTCTGTCCTTCCTACTGTAGG - Intergenic
1151356019 17:73559031-73559053 CATTCTTTCCTTCCCATGGGTGG - Intronic
1153309470 18:3663905-3663927 CAGACTTCCCTTCCTAAGGTGGG + Intronic
1155369299 18:25080999-25081021 CAGTCTTTCCTTCCTAATGGAGG + Intronic
1156333165 18:36144624-36144646 CTGTTTTTCCTTCCTCATTGTGG + Intronic
1157823422 18:50790474-50790496 CAGACAGTCCTTCCAAATGGGGG + Intergenic
1158231138 18:55256750-55256772 CAGTCTTTCTCTCCTCATGATGG - Intronic
1158839188 18:61365241-61365263 ATGTCTTTCATTCCTCATGGAGG - Intronic
1159000381 18:62968880-62968902 CACTCTCTCATTCCTAATGTTGG + Intronic
1159037554 18:63292452-63292474 AAGGCTTTCCTTTCTAATTGTGG + Intronic
1160280162 18:77482309-77482331 CAGCCTTCCCTTCCTATGGGAGG - Intergenic
1160863883 19:1248952-1248974 CAGTCTTTCGTTCCCGATCGGGG + Intronic
1164092845 19:21975880-21975902 AACTCTGTCCTGCCTAATGGGGG + Intronic
1166449768 19:42888599-42888621 AAGTATTTCTTTCCCAATGGTGG + Intronic
1166461068 19:42988897-42988919 AAGTATTTCTTTCCCAATGGTGG + Intronic
1166478358 19:43148881-43148903 AAGTATTTCTTTCCCAATGGTGG + Intronic
1167084564 19:47300359-47300381 CAGTCCATCCTTCCTGATGGGGG + Intronic
1167394414 19:49218667-49218689 AAGACATTCCCTCCTAATGGTGG + Intergenic
1168090426 19:54079505-54079527 CAGGTTGGCCTTCCTAATGGAGG + Intronic
926033975 2:9619665-9619687 TATTCTATCCTTCCAAATGGTGG + Intronic
927646923 2:24883430-24883452 CAAGCTTTCCTTCCTCATGGGGG - Intronic
928039268 2:27858027-27858049 CAGTATTTCCTTCCTTTTTGTGG - Intronic
929653067 2:43701439-43701461 CAATGTTTCCTTCCACATGGAGG - Intronic
931186281 2:59954452-59954474 CAGTGTTTCCTTTCTAATCCAGG - Intergenic
932672641 2:73751914-73751936 CTGTCTTCCCCACCTAATGGTGG - Intergenic
933412298 2:81941390-81941412 CAGTGTTTCCTTACTGAAGGGGG + Intergenic
937476876 2:122223524-122223546 CAGTCTTTCTGTTCTAAAGGAGG - Intergenic
938100720 2:128496328-128496350 CAGATTTCCCTTCCAAATGGGGG + Intergenic
938558871 2:132452165-132452187 CAGTCACTCCTTCCTTATGATGG - Intronic
941349747 2:164417468-164417490 CAGATTTTCCTTCCTAATGTAGG + Intergenic
941699574 2:168589589-168589611 GTGTCTTTCCTTCCAAATGTTGG + Intronic
944506432 2:200417186-200417208 CAGTCTACCCTTCCCAGTGGGGG + Intronic
945561296 2:211343953-211343975 AAGTCTTTCCTTCCTAAGTTTGG - Intergenic
946230180 2:218286506-218286528 CTCTGGTTCCTTCCTAATGGGGG - Exonic
946496113 2:220197151-220197173 CAGACTATCCTTACTCATGGAGG + Intergenic
946687643 2:222287246-222287268 CTTTCTTTCCTTCCTAATAAAGG - Intronic
947824856 2:233098724-233098746 GTGCCTGTCCTTCCTAATGGGGG + Intronic
1170262555 20:14426759-14426781 CCATTTTTCCTCCCTAATGGGGG - Intronic
1170278093 20:14615314-14615336 AAGTCCTTCATTCCTAAAGGAGG + Intronic
1171090904 20:22285096-22285118 CAGTATTTCCTTCATGAGGGAGG + Intergenic
1175611442 20:60354812-60354834 TAGTATTTCCTTCCTACTGTGGG + Intergenic
1175725356 20:61314439-61314461 CAGGATTTCCTTTCTTATGGTGG + Intronic
1176943074 21:14947411-14947433 CTCCATTTCCTTCCTAATGGTGG - Intergenic
1178252954 21:31022015-31022037 CACTCTTTCCTTCCTGTTGATGG + Intergenic
1178521806 21:33293025-33293047 CAATGCTTCCTTCCTAGTGGTGG + Intronic
1178729519 21:35086962-35086984 CAGTCAGACCTCCCTAATGGTGG + Intronic
1178754138 21:35331943-35331965 CAGATTTTCCTCCATAATGGGGG + Intronic
1181852820 22:25762157-25762179 CCTTCTTTCCTTCCTGATGTGGG - Intronic
1182406003 22:30130896-30130918 CAGGTCTTCCTTCCTAATAGGGG + Intronic
1183404552 22:37623989-37624011 CAGACCTTCCTCCCTAATGAGGG + Intronic
1183436715 22:37800369-37800391 CAGGATTTCCTTCTTATTGGTGG + Intergenic
949436005 3:4030028-4030050 CAGTCTTTCCCTCCTAAAAAAGG - Intronic
952868184 3:37872468-37872490 CAGTGCTTCTTTCCTGATGGGGG - Intronic
953633009 3:44635876-44635898 AAATCTTTCCTTCCTGGTGGAGG - Intronic
955474280 3:59319915-59319937 CAGTTTTCCCTTCCTTATGGAGG + Intergenic
955860226 3:63321694-63321716 CAGACTTTACTCCCTAAAGGAGG - Intronic
956162914 3:66373561-66373583 CACTCTTTCCTTCGTAAGGTAGG + Intronic
960279139 3:115761632-115761654 CAAGGTTTCTTTCCTAATGGAGG - Intergenic
960517301 3:118616518-118616540 CAGTCTTGCCTTTCTAAGAGAGG + Intergenic
962494875 3:135929127-135929149 CGGTCTTCCCTTCCTACTGCAGG - Intergenic
963344551 3:144079161-144079183 CAGATTTTCCTCCCTAATGTGGG + Intergenic
967252277 3:187552692-187552714 CAGTCTTTCCTTCACAAAGGTGG - Intergenic
967878388 3:194281939-194281961 CAGTGTTTCCTCCCAAATAGAGG - Intergenic
969894950 4:10295058-10295080 CTGTCTTTGTTTCCTAATGAGGG + Intergenic
970198063 4:13572693-13572715 GGGACTTACCTTCCTAATGGGGG + Intronic
971308994 4:25507651-25507673 CAGTCCTGCCTTCCTAGTGGTGG + Intergenic
972099758 4:35399853-35399875 CAGTCTTCACTTCCTTATGTTGG + Intergenic
973797968 4:54448342-54448364 CAGTGTTTTCTTCCTAAATGAGG + Intergenic
974243366 4:59281597-59281619 CAATTTGTTCTTCCTAATGGAGG - Intergenic
974600882 4:64077722-64077744 GAGTTCTTCCTTCCCAATGGAGG + Intergenic
976037287 4:80839363-80839385 CAGTATTTCCTTCCCCATGTAGG - Intronic
976140261 4:81984145-81984167 CAGTCTTTCTTTCCTAGAAGAGG - Intronic
977001881 4:91514940-91514962 CAGTTTGTTCTTCCTAATGTAGG - Intronic
977483849 4:97616318-97616340 CATTCTTTCCTTGCTAATTAAGG - Intronic
977546132 4:98380529-98380551 CTGTTTTTCCTTCCTTCTGGTGG + Intronic
978121002 4:105079355-105079377 CAGTGTTTCCTTTGGAATGGAGG - Intergenic
979499482 4:121422805-121422827 AAGACTCTACTTCCTAATGGGGG + Intergenic
979783778 4:124689497-124689519 CAGATTGTCCTTCCTAATGTGGG + Intronic
979884052 4:126001931-126001953 CAGTTTTTCTTCCCTAAGGGAGG - Intergenic
980176098 4:129346539-129346561 CATTCATTCGTTCCTAATAGGGG + Intergenic
982187600 4:152818729-152818751 CAGTTTTGCCTTCCAAATGTAGG + Intronic
983490362 4:168382294-168382316 CAGTCTTTTCTACCTAAATGTGG - Intronic
983749418 4:171247310-171247332 CAGTCTTTCCCTCCTAAGCATGG + Intergenic
983852481 4:172598982-172599004 GAGTCTTTCCTTCATAAAGTAGG + Intronic
984241690 4:177226978-177227000 CAGTCGTTCGTTCCTTCTGGTGG + Intergenic
984863732 4:184263009-184263031 CAGCCTTTCCTTCTGACTGGTGG - Intergenic
986174130 5:5337477-5337499 TAGTTTGTCCTTGCTAATGGAGG - Intergenic
988227960 5:28437955-28437977 CAGTCTTTCTTTCCATAAGGTGG + Intergenic
990779729 5:59346405-59346427 CAGTCTTGCCTTCCTCATGTTGG - Intronic
990851551 5:60210885-60210907 CTGCGTTTCCATCCTAATGGTGG + Intronic
991534966 5:67659395-67659417 CAGTCTTCCCATTCTGATGGAGG - Intergenic
994038879 5:95234515-95234537 CAGTCTTTCCCTCTTCTTGGAGG - Intronic
994061937 5:95487477-95487499 CAGTCTTTGGGTCCTAGTGGTGG - Intronic
994976990 5:106820500-106820522 CAGTACTTCATTCCTTATGGAGG + Intergenic
995416946 5:111923089-111923111 CTGTCTCTCCTTCCAATTGGTGG + Intronic
996487461 5:124053670-124053692 CAGTGTATCCTTCATAATGTGGG + Intergenic
998808971 5:145946863-145946885 CTGTCTTCCCTTCATATTGGAGG - Intronic
1004857083 6:19762248-19762270 CAGTCCTTCCTTTCTAAAGTGGG + Intergenic
1007901737 6:45420060-45420082 TACTCTGTCCTTCCTAATTGGGG - Intronic
1010079557 6:71844400-71844422 CAGTTTTTCCCTCCTTAAGGTGG + Intergenic
1013266990 6:108509443-108509465 CAGTCTTTATTTCAAAATGGTGG + Intronic
1019301003 7:303460-303482 CAGTATTTGCTTAATAATGGGGG + Intergenic
1019755551 7:2766288-2766310 CAGTCTTTCCTTTTTAAGGCTGG + Intronic
1019868586 7:3737092-3737114 ATGTCTTTCTTTCCTTATGGCGG + Intronic
1020863665 7:13527432-13527454 CATCCTTTGCTTCCTAATGTCGG - Intergenic
1020893668 7:13912218-13912240 CAGTCTTTCCTTCCCAGAGTGGG + Intronic
1022482608 7:30753712-30753734 CAGTCTTTCCCTCCCACAGGAGG + Exonic
1023379154 7:39588585-39588607 CAGTGTTTCTTTCCTAATAATGG + Intronic
1024248756 7:47490624-47490646 CAGGCTTCCCTTCATTATGGGGG - Intronic
1028284933 7:88984289-88984311 CAATCATTTCTTCTTAATGGAGG + Intronic
1028366407 7:90037662-90037684 CAGTCTTACCTTCCTAGCTGAGG - Intergenic
1028950070 7:96624684-96624706 GAGTCTTTCCTAGCTAATAGTGG - Intronic
1032045654 7:128605355-128605377 CAATCTTTCCTTACTAATTAAGG - Intergenic
1034230687 7:149525522-149525544 CAGTCTTTTATTTCTAATGCAGG + Intergenic
1035026449 7:155829867-155829889 CAGTCTTTCCTCCATAAAGCTGG + Intergenic
1037635063 8:20694224-20694246 CAGTTTACCCTTCATAATGGGGG + Intergenic
1038241438 8:25811515-25811537 CAGTATTACCTGCCTCATGGTGG - Intergenic
1039761621 8:40583006-40583028 CAGTCTCTTCTTCGTACTGGTGG - Intronic
1041032285 8:53749538-53749560 CAGTCTCTCGTTCCTGCTGGAGG + Intronic
1049000925 8:139825301-139825323 CACTCTTTCCCGCCGAATGGAGG + Intronic
1050620253 9:7444997-7445019 CTTTCTTTTCTTCCTAATTGAGG + Intergenic
1050655994 9:7829704-7829726 CAGTCTTTCCTTCAAAGTAGAGG - Intronic
1052343986 9:27389876-27389898 CAGTCTTTCCCTCTTAATCCTGG + Intronic
1055527322 9:77147968-77147990 AAGTCTTTTCTTTCTAGTGGAGG + Intergenic
1057665902 9:97045301-97045323 AAGTCTTTCCTTACTAATGTAGG + Intergenic
1059977080 9:119728980-119729002 GAGACTTTCCTTCCTGTTGGGGG + Intergenic
1060605641 9:124911487-124911509 CATTCTCTCCTTCCCAAGGGAGG - Intronic
1186611971 X:11146313-11146335 CACTGTTTCCTCCCTGATGGAGG - Intronic
1187528777 X:20077724-20077746 CAGGCTACCTTTCCTAATGGGGG + Intronic
1188592924 X:31861779-31861801 TAGTCTTTCCTTTCTTATGAAGG + Intronic
1191639481 X:63414765-63414787 CATTTTTTCCTTTCTAAAGGTGG - Intergenic
1195703183 X:107720319-107720341 CATTCATTCTTTCCTAATGGAGG - Intronic
1196328523 X:114438329-114438351 CAATCTTTCATTTCTATTGGGGG - Intergenic
1198001394 X:132441911-132441933 CAGTCCTTCATTCCTATTTGTGG - Intronic