ID: 1155370719

View in Genome Browser
Species Human (GRCh38)
Location 18:25097535-25097557
Sequence ACTGGCAATATGGGAGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 2, 3: 3, 4: 95}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155370712_1155370719 15 Left 1155370712 18:25097497-25097519 CCTGAAGACCGACGCTAGCACCT 0: 1
1: 0
2: 0
3: 2
4: 32
Right 1155370719 18:25097535-25097557 ACTGGCAATATGGGAGTGTCTGG 0: 1
1: 0
2: 2
3: 3
4: 95
1155370714_1155370719 7 Left 1155370714 18:25097505-25097527 CCGACGCTAGCACCTTCTAGGAG 0: 1
1: 0
2: 0
3: 3
4: 65
Right 1155370719 18:25097535-25097557 ACTGGCAATATGGGAGTGTCTGG 0: 1
1: 0
2: 2
3: 3
4: 95
1155370715_1155370719 -5 Left 1155370715 18:25097517-25097539 CCTTCTAGGAGTTTTGTCACTGG 0: 1
1: 0
2: 0
3: 11
4: 152
Right 1155370719 18:25097535-25097557 ACTGGCAATATGGGAGTGTCTGG 0: 1
1: 0
2: 2
3: 3
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155370719 Original CRISPR ACTGGCAATATGGGAGTGTC TGG Intronic
900166914 1:1247541-1247563 TCTGGCAAGAGGGGAGGGTCTGG - Intergenic
900523766 1:3118674-3118696 ACTGGCAGTCGGGGGGTGTCAGG + Intronic
901933097 1:12609478-12609500 ACTGTCAAGATGGAAGTGTCTGG - Intronic
902203526 1:14851369-14851391 GCTGGCAGTATGGGAGTGAGTGG - Intronic
903480165 1:23647237-23647259 ACTTGCAATATGGGAGGGCTGGG - Intergenic
904692676 1:32305983-32306005 CCAGGCAATATGTGTGTGTCTGG + Intronic
909274031 1:73661976-73661998 AATAACACTATGGGAGTGTCAGG - Intergenic
910399393 1:86823600-86823622 ACTTGGGATATGGAAGTGTCTGG - Intergenic
910449203 1:87329338-87329360 ACTTGCAATTTGGGACGGTCAGG - Intronic
917533074 1:175854433-175854455 AGTGGAAATATGGGGGTGTGGGG + Intergenic
918268772 1:182874336-182874358 ACTGGCACTTTGGGAGTTTTTGG + Intronic
923843260 1:237697679-237697701 ACTGGAAATTTGAGAGTGCCTGG + Intronic
1064201037 10:13285117-13285139 AATGAAAATATGTGAGTGTCTGG - Intronic
1065474519 10:26119566-26119588 ACTTGGAATATGGGAGTGAATGG + Intronic
1068754565 10:60637027-60637049 GCTGGCACTATGGGCGTGTTTGG - Intronic
1084066916 11:66709894-66709916 ACCGGCAACATGGGTGTGGCTGG - Intronic
1085651417 11:78272211-78272233 ACTGAAAATATGGAAGTGACAGG + Intronic
1090482264 11:127079083-127079105 TGTGGAAATACGGGAGTGTCTGG + Intergenic
1092906237 12:13102368-13102390 AGAGGGAATATGGGAGCGTCTGG - Intronic
1098310186 12:69140699-69140721 AGTGGCCTTGTGGGAGTGTCTGG + Intergenic
1103271623 12:119678159-119678181 GCTGGGAATATGAGAATGTCAGG + Intronic
1105906291 13:24813273-24813295 ACTAGCAATATGGGAGGCTGAGG - Intronic
1107842678 13:44475418-44475440 ACTGGCAGGGTGGGAGGGTCAGG + Intronic
1112686597 13:101835701-101835723 ACTGGCAAGATGGAGGTCTCTGG + Intronic
1116674622 14:47889664-47889686 AGTGGGAATATTGGAGTATCAGG + Intergenic
1117328937 14:54693844-54693866 CCTGGGAATAAGGGAGTGTAAGG + Intronic
1119039923 14:71264010-71264032 ACTGGCAACATGGGACTATTGGG - Intergenic
1119808337 14:77497432-77497454 ACTGGCACTATGGGAGGCTGAGG + Intronic
1122278351 14:100606931-100606953 ACTCCCAAGAGGGGAGTGTCTGG - Intergenic
1127501426 15:59557342-59557364 ACTGCCAGTCTGGGAGGGTCTGG - Intergenic
1127719720 15:61687852-61687874 ACTGGAAATATGACAGTGGCAGG + Intergenic
1133091438 16:3407297-3407319 ACTGTCAATATATGTGTGTCAGG + Intronic
1133728317 16:8557328-8557350 CCTGACAATATGGTAGTATCAGG - Intergenic
1135400076 16:22160831-22160853 AGTGGCAGTATTGGAGGGTCAGG - Intergenic
1137243286 16:46678160-46678182 ACAGGCAATATGGAAGTGAATGG - Intronic
1138863102 16:60783222-60783244 CCTGGCAACATGGCAGTGCCTGG + Intergenic
1140924651 16:79570627-79570649 ACTGGCTCTATGGGTGGGTCAGG + Intergenic
1142468326 17:148272-148294 GCTGGCAAGAAGGGAGTGTTAGG + Intronic
1142673394 17:1498030-1498052 GCCGGCGGTATGGGAGTGTCGGG + Exonic
1142717622 17:1755587-1755609 ACTGGCAATTAGGGAGTTTGTGG + Intergenic
1146308253 17:31747156-31747178 ACTGGCAACATGGGAGGCTGAGG - Intergenic
1149200045 17:54174876-54174898 AATTGCAATTTGGGAGTGTGAGG - Intergenic
1151196422 17:72435038-72435060 ACTTGCCATCTGGGTGTGTCTGG - Intergenic
1152812244 17:82387424-82387446 ACTGGAAATATCCGAGTTTCGGG - Intergenic
1153610841 18:6883211-6883233 ACTCTCAATTTGAGAGTGTCAGG + Intronic
1154024732 18:10696604-10696626 AGTGGCATGATGGCAGTGTCTGG - Intronic
1155370719 18:25097535-25097557 ACTGGCAATATGGGAGTGTCTGG + Intronic
1157477365 18:48031872-48031894 ACTGTGAAAATGGAAGTGTCGGG + Intronic
1162824753 19:13244642-13244664 ACTCTCAACATGGGAGTCTCTGG - Intronic
1166306996 19:41940723-41940745 ACTTGGAAGATGGGAGTGGCGGG + Intergenic
1166524139 19:43500572-43500594 ACTGGCATTTTGAGACTGTCTGG + Intronic
1202714664 1_KI270714v1_random:35670-35692 GCTGGCAATATGGGCATGCCGGG + Intergenic
925654904 2:6136103-6136125 ACTGGGAATATGGAGGTGTGGGG + Intergenic
932833201 2:75010503-75010525 ACTGGCAACATGGGATGGTGAGG + Intergenic
932871372 2:75402421-75402443 TGTGGCAATATGGGTGAGTCTGG - Intergenic
933469745 2:82706748-82706770 ACTGTTAATATGGGACTGCCTGG + Intergenic
937939772 2:127275988-127276010 ACTGGCAGTGTGTGAGTGTGAGG + Intronic
941555610 2:166976573-166976595 AGTGGGAAATTGGGAGTGTCAGG - Intronic
941985217 2:171503839-171503861 ACTCCCAATATGGTAGTGTTAGG - Intergenic
1173982292 20:47234022-47234044 GCTGGCAAGATGGAAGTGACAGG - Intronic
1175097426 20:56552600-56552622 TCTGACAATCTGGGAGTGGCGGG + Intergenic
1177552600 21:22645261-22645283 TCTGGCAAAATGGGAGTGGAGGG + Intergenic
1177759624 21:25388666-25388688 ACTGTCAGTTTGGGAGTGGCAGG - Intergenic
1179514596 21:41897980-41898002 CCAGGGAATATGGCAGTGTCTGG - Intronic
1179587869 21:42385122-42385144 ACAGGCACTCTGGGTGTGTCTGG - Intronic
1181520370 22:23445585-23445607 ACTGGAAGTATGTGACTGTCAGG - Intergenic
1181843382 22:25685329-25685351 ACTGGCAATGTGGGTCTTTCAGG + Intronic
1182994341 22:34799016-34799038 ACACGCAGTATGGGAGTGGCTGG - Intergenic
956696001 3:71919969-71919991 ACTGGGAAAAGGAGAGTGTCTGG - Intergenic
957994877 3:87676792-87676814 GCTGGGAATAAGGGAGTGTCAGG - Intergenic
963764144 3:149316199-149316221 ACTATCAATTTGGGAGTCTCTGG + Intergenic
967529845 3:190536072-190536094 ACTGGTAATATGGGGGTCTGGGG - Intronic
969552193 4:7877888-7877910 ACTGGCGATATGGGGGAGCCAGG - Intronic
972641820 4:40932464-40932486 ACTGGCAATATGGCAGTTTCTGG + Intronic
980779108 4:137474021-137474043 ACTCCCAATATGGCAGTGTTGGG - Intergenic
984419415 4:179501042-179501064 CCTAGCAATTTGGGAGTGCCAGG - Intergenic
988632255 5:32943846-32943868 CCAGGCAATATGGGAGTATGGGG + Intergenic
989686285 5:44091437-44091459 ACTGGCAAGTTGGCAGTGACTGG + Intergenic
990673729 5:58161220-58161242 CCTGGCAGGATGAGAGTGTCTGG + Intergenic
992164605 5:74037173-74037195 ACTGTCAATAGGGGAGTGGAAGG - Intergenic
992492922 5:77262707-77262729 ACTTGTAATATGCCAGTGTCTGG + Intronic
993407662 5:87531610-87531632 ACTGGGAATATGGCACTGTCTGG + Intergenic
996212367 5:120827168-120827190 ACTGGCAACATCTGAGTGGCAGG + Intergenic
998265011 5:140661522-140661544 CCTGGGATTATGGGAGAGTCTGG + Intronic
1004108779 6:12693683-12693705 CCTGGCATTATGGGAGTGTCAGG + Intergenic
1013056361 6:106586992-106587014 AATGGCATGATGGGAGTTTCTGG - Intronic
1018950222 6:168374200-168374222 ACTGGGACCATGGGAGGGTCTGG - Intergenic
1019590869 7:1830641-1830663 ACTGGAAGTATGTGACTGTCAGG + Intronic
1024282810 7:47733430-47733452 ACTGGCACTTTGGGAATGACAGG - Intronic
1030316831 7:108124791-108124813 ACTGGGAATATGGGAGTAGGAGG - Intronic
1036533393 8:9619709-9619731 ACCGGCAATATTGAGGTGTCTGG + Intronic
1042298572 8:67250135-67250157 ACAGACACTATGGGTGTGTCAGG + Intronic
1045896687 8:107226848-107226870 ACTAGAAAGATGGGATTGTCAGG - Intergenic
1046674563 8:117094027-117094049 ACTGGGAATGTGGTAGTGCCTGG + Intronic
1047664801 8:127079883-127079905 ACTGTAAATATGGGAGTGGGAGG - Intergenic
1049210903 8:141386029-141386051 ACTGGCAAGTGGGGAGTGACAGG - Intergenic
1059117151 9:111609990-111610012 GATGGCAAGATGGGAGTGTGTGG - Intergenic
1059241510 9:112810261-112810283 CCTGGCAATGTTGGAGGGTCTGG + Intronic
1060686780 9:125621978-125622000 ACTGGCAACATGGATGAGTCTGG + Intronic
1186655275 X:11605350-11605372 ACTGGGAATTTTGGAGTGCCTGG + Intronic
1195410225 X:104562239-104562261 ATTGGCAATGTGGGAGTGAGAGG - Intergenic